-
No products found
because this supplier's products are not listed.
Lars Borgards, et al.,
bioRxiv - Immunology 2023
Quote:
... The assay was performed according to the manufacturer’s instructions with a single technical replicate per sample (Uromodulin Human ELISA, BioVendor R&D, Cat. No.: RD191163200R; Azurocidin ELISA Kit, antibodies-online.com ...
-
No products found
because this supplier's products are not listed.
Lianghui Zhang, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... and levels of the IgG1 Fc moiety were measured by Human IgG ELISA Kit (Immunology Consultants Laboratory). To characterize different routes side-by-side ...
-
No products found
because this supplier's products are not listed.
Daniyal J Jafree, et al.,
bioRxiv - Pathology 2024
Quote:
... mouse monoclonal anti-platelet and endothelial cell adhesion molecule 1 (PECAM1/CD31 Aligent, GA610, clone: JC70A, 1:50) rabbit polyclonal anti-ssu-2 homolog (SSUH2, Atlas Antibodies, HPA049777, 1:100), rabbit polyclonal anti-fibulin 2 (FBLN2 ...
-
No products found
because this supplier's products are not listed.
Chao Liu, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... Ang-(1-7) concentration was measured using ELISA kit (S-1330, Bachem, CA, USA)
-
No products found
because this supplier's products are not listed.
C. Sahara Khademullah, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Human and mouse Plasma and CSF samples were probed for KCC2 in a mouse SLC12A5 Sandwich ELISA kit (Cedarlane, LS-F65788).
-
No products found
because this supplier's products are not listed.
Miriana Battista, et al.,
bioRxiv - Microbiology 2023
Quote:
... The level of interleukin (IL)-6 and tumor necrosis factor (TNF)-α was also quantified by Human IL-6 and TNF-α ELISA Kits (ImmunoTools), respectively.
-
No products found
because this supplier's products are not listed.
Kouhei Yoshida, et al.,
bioRxiv - Bioengineering 2023
Quote:
The AAV Titration ELISA Kit series (PROGEN Biotechnik GmbH) was used to quantify AAV capsid titers depending on the AAV serotype ...
-
No products found
because this supplier's products are not listed.
Seung-Eon Roh, et al.,
bioRxiv - Neuroscience 2023
Quote:
... CSF Orexin A was detected using a competitive ELISA Kit (Phoenix Pharmaceuticals) (Liguori et al ...
-
No products found
because this supplier's products are not listed.
Esther B. Florsheim, et al.,
bioRxiv - Immunology 2023
Quote:
... ELISA-grade plates (490012-252, VWR) were coated overnight at 4°C with 2 µg/mL of anti-mouse IgE (553413 ...
-
No products found
because this supplier's products are not listed.
Eleonora Grisard, et al.,
bioRxiv - Cell Biology 2021
Quote:
... rabbit anti-human Lamp1 1/1000 (clone EPR4204, GeneTex), mouse anti-Gapdh (clone 1E6D9 ...
-
No products found
because this supplier's products are not listed.
JM Robinson, et al.,
bioRxiv - Immunology 2019
Quote:
... and LBP (Human Lipopolysaccharide Binding Protein ELISA Kit, Cell Sciences, Inc., Cat# CKH113).
-
No products found
because this supplier's products are not listed.
Yuting Zeng, et al.,
bioRxiv - Cell Biology 2022
Quote:
... The human EDN enzyme-linked immunosorbent assay (ELISA) kit (MBL International 7630, Woburn, MA) has a minimum detection limit of 0.62 ng/mL ...
-
No products found
because this supplier's products are not listed.
Jia-Pu Liang, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Dex ELISA kit (Cat. No. 101516; Neogen) and E2 High sensitivity ELISA kit (Cat ...
-
No products found
because this supplier's products are not listed.
Jan Fischer, et al.,
bioRxiv - Developmental Biology 2020
Quote:
Human SC102A-1 (System Bioscience) and chimpanzee Sandra A iPSC lines (Camp et al. ...
-
No products found
because this supplier's products are not listed.
Joseph Hiatt, et al.,
bioRxiv - Genetics 2020
Quote:
... 1% Human AB Serum (Valley Biomedical HP1022HI), Penicillin-Streptomycin (100IU and 100µg/mL ...
-
No products found
because this supplier's products are not listed.
Charlie J. Childs, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Human Fibrinogen 1 Plasminogen Depleted (Enzyme Research Lab Cat#FIB-1), and X-Vivo 20 (Lonza Cat#190995) ...
-
No products found
because this supplier's products are not listed.
Jennifer M. Zupancic, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Tissue staining was performed at room temperature using a Human-on-Human HRP-Polymer kit (Biocare Medical, BRR4056KG). Briefly ...
-
No products found
because this supplier's products are not listed.
Damian Dudka, R. Brian Akins, Michael A. Lampson,
bioRxiv - Cell Biology 2023
Quote:
... Centromeres were labeled with CREST (human anti-human Anti-Centromere Antibody, 1:200, Immunovision, HCT-0100) and an Alexa Fluor 594–conjugated goat anti-human secondary antibody (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Jan Clement Santiago, et al.,
bioRxiv - Microbiology 2020
Quote:
... 1 ng human genomic DNA (Bioline, Cat. # BIO-35025) was used as negative control ...
-
No products found
because this supplier's products are not listed.
Zijun Wang, et al.,
bioRxiv - Immunology 2021
Quote:
... The developing reaction was stopped by adding 50 μl 1 M H2SO4 and absorbance was measured at 450 nm with an ELISA microplate reader (FluoStar Omega 5.11, BMG Labtech) with Omega MARS software for analysis ...
-
No products found
because this supplier's products are not listed.
Christian Heuss, et al.,
bioRxiv - Microbiology 2022
Quote:
... −20M and GLT1cc infected human liver chimeric mice using the NucleoSpin Virus kit (Macherey-Nagel) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Rebecca Garnham, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Human ST3Gal1 sandwich pre-validated ELISA kits were purchased from Cambridge Bioscience (RayBioTech, ELH-ST3GAL1). Samples and standards were assayed in duplicate according to the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Helle Samdal, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and 2.5 μg anti-enhancer of zeste homolog 2 (EZH2) (Diagenode, C15200180). Antibody-protein complexes were immunoprecipitated with protein A/G Dynabeads for 3 hours at 4°C with rotation ...
-
No products found
because this supplier's products are not listed.
Lisa Pomeranz, et al.,
bioRxiv - Bioengineering 2023
Quote:
ELISA plates were coated with 1µg/mL human spleen ferritin (Lee Biosolutions, MO) in PBS overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Josefa Cruz, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... ELISA was performed according to the manufacturer’s instructions using a commercial ELISA kit (Bertin Bioreagents) that detects ecdysone and 20- hydroxyecdysone with the same affinity ...
-
No products found
because this supplier's products are not listed.
Khushali Patel, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... ELISAs were performed using a β-hCG ELISA kit (EIA-1911; DRG International Springfield NJ) and IL-1β ELISA kit (DY401-05 ...
-
No products found
because this supplier's products are not listed.
Tetsuro Yamamoto, et al.,
bioRxiv - Immunology 2023
Quote:
... Monkey IFN-gamma ELISA Kit (U-CyTech biosciences), and Monkey IL-17 ELISA Kit (U-CyTech biosciences) ...
-
No products found
because this supplier's products are not listed.
Skylar J. Ferrara, et al.,
bioRxiv - Immunology 2021
Quote:
... Quantification of TREM2 concentration via ELISA was performed using a TREM2 ELISA kit (Reddot Biotech Inc). following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
RE Akhigbe, A.F Ajayi,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
ELISA kits used for the analysis of reproductive hormones were from Monobind Inc. ...
-
No products found
because this supplier's products are not listed.
Julianne Meisner, et al.,
bioRxiv - Microbiology 2022
Quote:
... 2) 1:100 dilution of test sera (diluted in ChronBlock ELISA Buffer-Chondrex Inc.); 3 ...
-
No products found
because this supplier's products are not listed.
Lindsey A Allan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... human ACA (90C-CS1058 from Fitzgerald, 1:2000), rabbit Cyclin B1 (#12231S from Cell signalling technology ...
-
No products found
because this supplier's products are not listed.
Erin M. Harberts, et al.,
bioRxiv - Immunology 2021
Quote:
... to Immulon ELISA plates (ImmunoChemistry Technologies) that were pre-coated with anti-IL-1β capture antibody (eBioscience) ...
-
No products found
because this supplier's products are not listed.
Maurice Michel, et al.,
bioRxiv - Biochemistry 2024
Quote:
... goat anti-human IgG-Fc Alexa488 (Dianova, 1:400) or goat antihuman IgM Alexa 594 (Molecular Probes ...
-
No products found
because this supplier's products are not listed.
Bing Han, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
No products found
because this supplier's products are not listed.
Yonghui Ding, et al.,
bioRxiv - Bioengineering 2023
Quote:
... were expanded in human SMC growth medium kit (Cell Applications, Inc., 311K-500) under the standard culture condition (37 °C with 5% CO2 in a humid environment ...
-
No products found
because this supplier's products are not listed.
Marisol Sampedro-Castañeda, et al.,
bioRxiv - Neuroscience 2023
Quote:
... mouse anti Cav α1E 1:1000 (Synaptic Systems, 152411, human neurons), rabbit anti CDKL5 1:2000 (Atlas ...
-
No products found
because this supplier's products are not listed.
Qinqin Fei, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... human epithelial cell (HEC) media with the supplemental kit was purchased from Cell Biologics Inc ...
-
No products found
because this supplier's products are not listed.
Kameron Y. Sugino, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Maternal serum samples collected at 0.6 G were analyzed for C-reactive protein (CRP) using an hsCRP ELISA kit (MP Biomedicals, Solon, OH) according to the manufacturer’s protocol with 1:100 serum dilution and were analyzed for IL-6 using an old world monkey IL-6 ELISA kit (U-CyTech Biosciences ...
-
No products found
because this supplier's products are not listed.
James S. Novak, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Muscle sections were also immunostained with human-specific spectrin (SPEC1-CE, 1:50, Leica) and human-specific lamin A/C (ab40567 ...
-
No products found
because this supplier's products are not listed.
Dennis J. Doorduijn, et al.,
bioRxiv - Microbiology 2021
Quote:
... for C5b6 with 1:500 dilution of goat-anti human C5 serum (Complement Technology) and for sMAC with 1 µg/ml biotinylated monoclonal anti-C7 (clone F10 ...
-
No products found
because this supplier's products are not listed.
Jan Steinkühler, et al.,
bioRxiv - Biophysics 2020
Quote:
... Human Transferrin – CF488A (Biotium) at 130 nM ...
-
No products found
because this supplier's products are not listed.
Jianing Song, et al.,
bioRxiv - Biochemistry 2020
Quote:
... human BDNF (2837, Tocris), PACAP-38 (4031157 ...
-
No products found
because this supplier's products are not listed.
Anne-Claire Langlois, et al.,
bioRxiv - Microbiology 2020
Quote:
Human HDL lipoproteins (LP3, Calbiochem) were labeled using the Cy5 monoreactive Dye pack (PA25001 ...
-
No products found
because this supplier's products are not listed.
Erin A. Stephens, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... 50 μM human ubiquitin (Boston Biochem), 4 mM ATP and 1 mM DTT in 20 mM MOPs ...
-
To help researchers in the global fight against the coronavirus, abm has developed an RT-qPCR...
Cat# G628,
100 Rxns/kit, please contact supplier for pricing.
Ask
Tamara Miljuš, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
For all experiments human embryonic kidney (HEK) 293SL cells84 were used and regularly tested for mycoplasma contamination (PCR Mycoplasma Detection kit, ABM, Canada). HEK293SL cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) ...
-
No products found
because this supplier's products are not listed.
Jessica Ciesla, Isreal Moreno Jr., Joshua Munger,
bioRxiv - Microbiology 2022
Quote:
TNFα (Human) was purchased from GoldBio (#1130-01-100) and suspended in sterilized water to 1 mg/mL concentration ...
-
No products found
because this supplier's products are not listed.
Halil Ibrahim Guler, et al.,
bioRxiv - Molecular Biology 2021
Quote:
ELISA KIT of COVID-19 spike protein:ACE-2 assay kit (Cat. No. 79954) was purchased from BPS Bioscience (79954), San Diego ...
-
No products found
because this supplier's products are not listed.
Cheyenne Hurst, et al.,
bioRxiv - Neuroscience 2022
Quote:
... recombinant human Aβ42 (5 μM) (rPeptide, # A-1170-1) was handled essentially as described (67 ...
-
No products found
because this supplier's products are not listed.
Damon A. Hofman, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... human EGF (20ng/mL; Shenandoah Biotech), human FGF-basic-154 (20ng/mL ...
-
No products found
because this supplier's products are not listed.
Baishakhi Ghosh, et al.,
bioRxiv - Cell Biology 2021
Quote:
Primary non-diseased human bronchial epithelial (NHBE) and COPD human bronchial epithelial (CHBE) cells were purchased from MatTek Life Sciences (Ashland ...