-
No products found
because this supplier's products are not listed.
Brian C. Russo, et al.,
bioRxiv - Microbiology 2021
Quote:
... The cells were then incubated overnight at 4°C with rabbit anti-Shigella conjugated to FITC (ViroStat, catalog no. 0903). The next day ...
-
No products found
because this supplier's products are not listed.
William A. Comrie, et al.,
bioRxiv - Immunology 2019
Quote:
µm in depth with 5.0 µm pores at a density of 4×105 pores/cm2 (Neuro Probe, Inc., Gaithersburg, MD). The filter frame was replaced on the 96-well plate and 25 ul (75,000 cells ...
-
No products found
because this supplier's products are not listed.
Arumoy Chatterjee, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... The deuterated internal standards 2-(4-Hydroxyphenyl)ethyl-1,1,2,2-d4-amine HCl and beta-Hydroxytyramine (α-d2, β-d1) HCl were supplied by Medical Isotopes, Inc ...
-
No products found
because this supplier's products are not listed.
Soner Sonmezoglu, et al.,
bioRxiv - Bioengineering 2021
Quote:
... tris-(Bathophenanthroline) Ruthenium (II) Perchlorate (Ru(dpp)3(ClO4)2) (CAS 75213-31-9; GFS Chemicals), were immobilized on the surface of silica particles with a diameter of 10 µm (CAS 7631-86-9 ...
-
No products found
because this supplier's products are not listed.
Raza Ali Naqvi, Araceli Valverde, Afsar Naqvi,
bioRxiv - Immunology 2023
Quote:
... Gene expression was examined using PCR array plate containing 88 primer sets directed against human NF-κB pathway genes and 8 housekeeping primer sets (Real Time Primers, LLC Elkins Park, PA). Briefly ...
-
No products found
because this supplier's products are not listed.
Qianying Zuo, et al.,
bioRxiv - Cancer Biology 2022
Quote:
IN SITE Metastasis Kit (Xylyx Bio, Inc., NY) containing TissueSpec Bone (MTSBN101) ...
-
No products found
because this supplier's products are not listed.
Léa Pinon, et al.,
bioRxiv - Synthetic Biology 2024
Quote:
... FujiFilm collagen I (LabChem Wako, Collagen-Gel Culturing Kit) has been used to obtain the 2.4 mg/ml solution ...
-
No products found
because this supplier's products are not listed.
Nishith M Shrimali, et al.,
bioRxiv - Pathology 2021
Quote:
... and incubated with collagen (10 µg/ml) or ADP (2 µM, both from the Bio/Data Corporation, USA) 10 minutes ...
-
No products found
because this supplier's products are not listed.
Matthew D. Kerr, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 1-bicyclo[2.2.1]hept-5-en-2-ylmethanamine (norbornene amine) was purchased from Matrix Scientific (# 038023, lot: M15S). Cy5-tetrazine amine was purchased from Lumiprobe (lot ...
-
No products found
because this supplier's products are not listed.
Arthur J. Jallet, Arnaud Le Rouzic, Anne Genissel,
bioRxiv - Evolutionary Biology 2019
Quote:
... 50 mL of frozen cell suspension were lyophilized for 3 days (LYOVACTM GT 2-E freeze dryer, Steris) and ground in liquid nitrogen to a fine powder with a mortar and pestle ...
-
No products found
because this supplier's products are not listed.
Takao Fujisawa, et al.,
bioRxiv - Cell Biology 2023
Quote:
Recombinant proteins or ZnCl2 solution for normalization was incubated with 10 µM ZnAF-2 (Goryo Chemical, SK2001-01) in TBS for 30 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Yuichiro Honda, et al.,
bioRxiv - Pathology 2020
Quote:
... The sections were blocked with 5% bovine serum albumin in PBS for 60 min and incubated overnight at 4°C with a mouse anti-CD-11b primary antibody (1:2000; BMA Biomedicals, Augst, Switzerland) or a rabbit polyclonal anti-dystrophin primary antibody (1:1000 ...
-
No products found
because this supplier's products are not listed.
Charles E. Mackay, et al.,
bioRxiv - Physiology 2021
Quote:
... Arterial segments 1-2 mm in length were cannulated at each end in a perfusion chamber (Living Systems Instrumentation) continuously perfused with PSS and maintained at 37°C ...
-
No products found
because this supplier's products are not listed.
Kyla D Omilusik, et al.,
bioRxiv - Immunology 2021
Quote:
... 1-1.5 mg of protein lysate was incubated with Id2 (9-2-8, CalBioeagents) or Id3 (6-1, CalBioreagents) antibody overnight at 4°C followed by protein A/G agarose beads (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Wilfred A. Jefferies, et al.,
bioRxiv - Immunology 2023
Quote:
... or LNP-B.1.617.2 (Delta) spike protein variant of the SARS-CoV-2 virus (Cat # PM-LNP-12) mRNA purchased from Promab Biotechnologies ...
-
No products found
because this supplier's products are not listed.
Gregory M Wright, et al.,
bioRxiv - Cell Biology 2023
Quote:
... FISH was performed using probes for the MT locus in 16q12.2 (56,396,107 to 56,782,063 on chromosome 16 in GRCh37) and chromosome 16 α-satellite purchased from Oxford Gene Technology, who performed paired-end sequencing to verify the identity of the BACs ...
-
No products found
because this supplier's products are not listed.
Biswapriya Biswavas Misra, et al.,
bioRxiv - Systems Biology 2019
Quote:
... A high-sensitivity assay kit (Kamiya Biomedical, Seattle, WA, USA), with a latex particle-enhanced immunoturbidometric method ...
-
No products found
because this supplier's products are not listed.
Juana G. Manuel, et al.,
bioRxiv - Genomics 2023
Quote:
... we mixed with regular pipette tips 3 – 4 times to break up clumps and then used wide bore pipette tips to reduce shearing (Labcon 1199-965-008-9) to continue mixing ...
-
No products found
because this supplier's products are not listed.
David Jukam, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Eggs were irradiated by placing the 6 cm petri dish in a dark chamber for 2 minutes under a 500 Watt Hg arc lamp (Oriel Instruments) producing a downward facing focused beam with diameter of ∼8 cm such that every egg in the dish was covered by the UV light ...
-
No products found
because this supplier's products are not listed.
Christopher D. Pull, et al.,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
We measured the foraging success of individual bees on exiting and re-entering the colony using weight-averaging scales for moving subjects (mean of three repeat measurements with 2s averaging and accuracy of ± 2 mg; Advanced portable balance Scout STX123 120g; OHAUS Corporation) and their lifetime foraging activity and survival using an RFID system (MicroSensys GmBH ...
-
No products found
because this supplier's products are not listed.
Sara Castagnola, et al.,
bioRxiv - Genomics 2020
Quote:
... was performed before cutting the brains sagittally in six equally thick sections (2 mm) using a mouse brain matrix slicer (CellPoint Scientific) and 5 razorblades ...
-
No products found
because this supplier's products are not listed.
Shuyong Jia, et al.,
bioRxiv - Bioengineering 2020
Quote:
... The classic LDFs of both control points (points 1 and 2) were recorded by a PeriFlux 5000 (Perimed AB, Stockholm, Sweden) system with a 64-Hz sampling rate ...
-
No products found
because this supplier's products are not listed.
Eric Esposito, et al.,
bioRxiv - Cell Biology 2021
Quote:
... The RNA was further purified by twice mixing the aqueous supernatant with 700 μL of acidic phenol chloroform and centrifuging the solution in a 5Prime Phase Lock Gel Heavy 2 ml tube (Andwin Scientific) at 16,000 rcf to separate the phases ...
-
No products found
because this supplier's products are not listed.
Geraldine Nouailles, et al.,
bioRxiv - Immunology 2022
Quote:
... The plates were covered and incubated for 2 h at room temperature before the washing step was repeated and 50 μL of secondary antibody (Brookwood biomedical, Rabbit Anti-Hamster IgA ...
-
No products found
because this supplier's products are not listed.
Shengyun Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...
-
No products found
because this supplier's products are not listed.
Anne Tersteegen, et al.,
bioRxiv - Immunology 2021
Quote:
Total DNA was isolated from tissues using a DNA isolation kit (Genekam) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Nora Hartig, Kathrin M. Seibt, Tony Heitkam,
bioRxiv - Plant Biology 2022
Quote:
... PCR products were purified (As One International,Invisorb Spin DNA Extraction Kit) and ligation into pGEM-T plasmids (ThermoFisher Scientific ...
-
No products found
because this supplier's products are not listed.
Dominique Vanhecke, Viola Bugada, Thorsten Buch,
bioRxiv - Animal Behavior and Cognition 2023
Quote:
... Both MOE and SOE emulsions were freshly made on the day of treatment by emulsification during 10 minutes at room temperature using 2 mL Luer-Lock syringes (Braun # 4606701V) connected with a one-way Luer female to female adaptor (Cadence Science #6521IND).
-
No products found
because this supplier's products are not listed.
Roberto Balbontín, Nelson Frazão, Isabel Gordo,
bioRxiv - Microbiology 2020
Quote:
... In the competitions including the RNase HI inhibitor 2-[[[3-Bromo-5-(2-furanyl)-7-(trifluoromethyl)pyrazolo[1,5-a]pyrimidin-2-yl]carbonyl]amino]-4,5,6,7-tetrahydro-benzo[b]thiophene-3-carboxylic acid ethyl ester (RHI001, Glixx Laboratories Inc., catalog number GLXC-03982), the medium was supplemented with 500 µM of RHI001 ...
-
No products found
because this supplier's products are not listed.
Anouschka S. Ramsteijn, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Cages were enriched with wooden stick for gnawing (10×2×2cm) and nesting material (Enviro-dri™, Shepherd Specialty Papers, Richland, MI, USA), and were cleaned weekly ...
-
No products found
because this supplier's products are not listed.
Jessica Trinh, et al.,
bioRxiv - Plant Biology 2023
Quote:
... water was replaced with 500 μL of either water or water containing MAMP before pressure-infiltrating for 2 minutes at 30 mm Hg in a vacuum desiccator (SP Bel-Art #F42025-0000). Leaf disks were collected at 0 ...
-
No products found
because this supplier's products are not listed.
Chan Cao, et al.,
bioRxiv - Biophysics 2023
Quote:
... EBCs were lysed and further treated using the Hemovoid kit (Biotech Support Group), aiming to remove hemoglobin (the most abundant protein in RBCs ...
-
No products found
because this supplier's products are not listed.
Tyler P. Nicholas, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... or to silver nanoparticles (AgNP; 20 nm, gold-core, citrate-coated, at 1 mg/mL in 2 mM sodium citrate; nanoComposix, San Diego, CA, USA) for an acute exposure of 24 hours ...
-
No products found
because this supplier's products are not listed.
Pranjali Beri, et al.,
bioRxiv - Bioengineering 2022
Quote:
... The uncured LSR was vulcanized at 150°C for 2 minutes using a hydraulic lab press equipped with heated platens (Carver Bench Top Auto Press) then demolded from the tool.
-
No products found
because this supplier's products are not listed.
Yumaine Chong, Ellis Cooper,
bioRxiv - Neuroscience 2022
Quote:
... was injected into the anterior chamber of the eye using a 33G x 1/2” TSK SteriJect hypodermic needle (Air-Tite Products, Virginia Beach, VA) fitted onto a 25μL Gastight Hamilton syringe (Hamilton Company ...
-
No products found
because this supplier's products are not listed.
Carmen RB da Silva, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... The volumetric flow rates produced by the flow controllers was measured using a Gilian Gilibrator–2 NIOSH Primary Standard Air Flow Calibrator with a low–flow cell (Sensidyne, LP, St Petersburg, FL, USA) and corrected to standard temperature pressure ...
-
No products found
because this supplier's products are not listed.
Bapi Biswas, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... donovani amastigotes in whole lysate was checked by Lipase Assay Kit (REAlGENE, US, Cat # 250069) expressed in Unit/μg ...
-
No products found
because this supplier's products are not listed.
Walker D. Short, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... HA concentration was confirmed in the extracted samples with a Hyaluronic Acid test kit (Corgenix Specialists in ELISA & IVD Diagnostic Technology ...
-
No products found
because this supplier's products are not listed.
William C.W. Chen, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... Gibson reactions were performed with the Gibson Assembly Ultra Kit (SGI-DNA, La Jolla, CA, USA) at 50°C for 60 min ...
-
No products found
because this supplier's products are not listed.
Nathan W. Zammit, et al.,
bioRxiv - Immunology 2019
Quote:
... Cells were lysed and adenoviruses were extracted using Aenopure kit according to instructions provided (PureSyn Inc.). The purified virus was titrated and quantified in HEK293 cells using the Adeno-X Rapid Titer Kit (clontech ...
-
No products found
because this supplier's products are not listed.
Veronica Ferrucci, et al.,
bioRxiv - Genetics 2020
Quote:
... Real-time RT-PCR was performed using ‘RealQquality RQ-2019-nCoV’ kits (Ab Analitica; IVD approved) for detection of the RdRp and E genes (from the SarsCov2 N gene) ...
-
No products found
because this supplier's products are not listed.
Kristina Haslinger, et al.,
bioRxiv - Biochemistry 2020
Quote:
... we used the TR-FRET Bridge-It® S-Adenosyl Methionine (SAM) Fluorescence Assay Kit from Mediomics LLC (St ...
-
No products found
because this supplier's products are not listed.
Rosalia Emma, et al.,
bioRxiv - Biochemistry 2022
Quote:
... the bacterial suspensions were immediately used for AMES screening by following manufacturer’s protocol (Salmonella Mutagenicity Test Kit, MOLTOX®). Briefly ...
-
No products found
because this supplier's products are not listed.
Arundhasa Chandrabalan, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... All joint fluids were tested for presence of any blood with the Fecal Occult Blood Test kit (Immunostics Hema-Screen) and the samples showing presence of blood were excluded from further analysis.
-
No products found
because this supplier's products are not listed.
Christopher A. Hempel, et al.,
bioRxiv - Genomics 2022
Quote:
DNA and total RNA were separately extracted from samples in 96-well plates using the NucleoMag DNA/RNA Water kit (D-MARK Biosciences, Toronto, Canada) that includes magnetic beads ...
-
Cat# IAR42411996,
Inquire
No citation found on bioRxiv
-
No citation found on bioRxiv
-
Cytochrome P450 2C9 is a cytochrome P-450 subtype that has specificity for acidic XENOBIOTICS....
Cat# SMD789,
Customizable size, Inquiry
No citation found on bioRxiv
-
Catalog Number: B2011344 (2.5 mg)
Pentoxyresorufin (Cytochrome P450 substrate) is a high...
Cat# B2011344,
USD $495.0
No citation found on bioRxiv
-
The CYP4F2 ORF Vector holds the gene (cloned by a restriction enzyme-independent method) between...
Cat# 1749301.0,
1.0 μg DNA, NM_001082 (Human), Inquire
No citation found on bioRxiv