-
No products found
because this supplier's products are not listed.
JM Robinson, et al.,
bioRxiv - Immunology 2019
Quote:
... and LBP (Human Lipopolysaccharide Binding Protein ELISA Kit, Cell Sciences, Inc., Cat# CKH113).
-
No products found
because this supplier's products are not listed.
MD Fahlberg, et al.,
bioRxiv - Immunology 2020
Quote:
... and Kynurenine ELISA commercial kits (Rocky Mountain Diagnostics, Colorado Springs ...
-
No products found
because this supplier's products are not listed.
Renaud Mevel, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... 10 mM Y-27632 dyhydrochloride (Chemdea, #CD0141), 200nM A83-01 (Tocris Bioscience ...
-
No products found
because this supplier's products are not listed.
David Welch, et al.,
bioRxiv - Biophysics 2021
Quote:
We used the 3-D human skin model EpiDerm-FT (MatTek Corp., Ashland, MA) which is derived from single adult donors ...
-
No products found
because this supplier's products are not listed.
Marcel Lagedroste, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Membranes were solubilized with 1% (w/v) of the lipid-like detergents FC-16 (Anatrace) for 1 h at 8°C ...
-
No products found
because this supplier's products are not listed.
Yurika Ito, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... Female Dmd-/y mice crossed with male NSG mice (Charles River) (Sato et al. ...
-
No products found
because this supplier's products are not listed.
Andrew J. Stout, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 10ng/mL insulin-like growth factor 1 (IGF-1; Shenandoah Biotechnology #100-34AF-100UG, Warminster, PA, USA) and 10 ng/mL epidermal growth factor (EGF ...
-
No products found
because this supplier's products are not listed.
Maria Llamazares Prada, et al.,
bioRxiv - Cell Biology 2023
Quote:
The human AT2-like cell line A549 (CCL-185, ATCC) was grown in Ham’s F12 medium (PAN Biotech, P04-14550) supplemented with 10% fetal bovine serum (FBS ...
-
No products found
because this supplier's products are not listed.
Jia-Pu Liang, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Dex ELISA kit (Cat. No. 101516; Neogen) and E2 High sensitivity ELISA kit (Cat ...
-
No products found
because this supplier's products are not listed.
Lisa Pomeranz, et al.,
bioRxiv - Bioengineering 2023
Quote:
ELISA plates were coated with 1µg/mL human spleen ferritin (Lee Biosolutions, MO) in PBS overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Khushali Patel, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... ELISAs were performed using a β-hCG ELISA kit (EIA-1911; DRG International Springfield NJ) and IL-1β ELISA kit (DY401-05 ...
-
No products found
because this supplier's products are not listed.
Tetsuro Yamamoto, et al.,
bioRxiv - Immunology 2023
Quote:
... Monkey IFN-gamma ELISA Kit (U-CyTech biosciences), and Monkey IL-17 ELISA Kit (U-CyTech biosciences) ...
-
No products found
because this supplier's products are not listed.
Skylar J. Ferrara, et al.,
bioRxiv - Immunology 2021
Quote:
... Quantification of TREM2 concentration via ELISA was performed using a TREM2 ELISA kit (Reddot Biotech Inc). following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Marius Regin, et al.,
bioRxiv - Developmental Biology 2023
Quote:
Vitrified high quality 8-cell stage human embryos (3 dpf) were warmed (Vit Kit -Thaw, Irvine Scientific, USA) and cultured until 6 dpf in individual microdroplets of 25µl medium (Quinn’ s Advantage™ Blastocyst media ...
-
No products found
because this supplier's products are not listed.
Karin A. Jansen, et al.,
bioRxiv - Biophysics 2020
Quote:
Human fibrinogen (FIB 3) and human α-thrombin were obtained from Enzyme Research Laboratories (Swansea, UK). FIB 3 was depleted from plasminogen ...
-
No products found
because this supplier's products are not listed.
Eoin McEvoy, et al.,
bioRxiv - Biophysics 2021
Quote:
... Y-27632 (Y100500; Toronto Research Chemicals) was prepared from 10-mM stock in water and cells treated were treated with 50 μM Y-27632 in culture medium for 1-hr ...
-
No products found
because this supplier's products are not listed.
Chien-Wei Wang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... anti-CA125 epitope group A (Fitzgerald, OC125-like, M61704, 1:2000), anti-CA125 epitope group B (Agilent ...
-
No products found
because this supplier's products are not listed.
Shuting Cao, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and eosin Y stain (American MasterTech, STE0157), or H&E stain ...
-
No products found
because this supplier's products are not listed.
Dika A. Kuljis, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Virus was introduced through a small craniotomy (from bregma: x=−3, y=−0.9, z=−0.5 mm) using a Nanoject II (Drummond Scientific Company; Broomall, PA) in isoflurane anesthetized mice at P15-17 ...
-
No products found
because this supplier's products are not listed.
Allison Coté, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and cyclin mRNA (labelled in either atto700 or atto647N) (Stellaris oligonucleotides, Biosearch Technologies). Samples were then washed twice with 2 X saline sodium citrate buffer (SSC ...
-
No products found
because this supplier's products are not listed.
Lijin Zou, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... The human proteins were assigned to 3 Piggybac vectors (System Biosciences, USA) by Golden Gate Assembly method (11 ...
-
No products found
because this supplier's products are not listed.
RE Akhigbe, A.F Ajayi,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
ELISA kits used for the analysis of reproductive hormones were from Monobind Inc. ...
-
No products found
because this supplier's products are not listed.
Brahmaiah Pendyala, et al.,
bioRxiv - Microbiology 2020
Quote:
... assay (Catalog #79955) and papain-like protease (SARS-CoV-2) assay kit: protease activity (Catalog #79995) were purchased from BPS Bioscience (San Diego, CA).
-
No products found
because this supplier's products are not listed.
Rebecca J. Edgar, et al.,
bioRxiv - Microbiology 2019
Quote:
... 32 using the AmpliteTM Fluorimetric sn-Glycerol-3-Phosphate (Gro-3-P) Assay Kit (AAT Bioquest). GAC was released from cell wall by sequential digestion with mutanolysin hydrolase and PlyC amidase ...
-
No products found
because this supplier's products are not listed.
Wei Liu, et al.,
bioRxiv - Bioengineering 2022
Quote:
Transfection of human pancreatic MIA PaCa-2 and BxPC-3 cells was performed with TransIT-mRNA (Mirus Bio) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
LiangYu Zhao, et al.,
bioRxiv - Genomics 2020
Quote:
... DNA-FISH was performed according to the guidelines of the CEP X SpectrumOrange/Y SpectrumGreen DNA Probe Kit (Abbott, 07J20-050 and 07J20-050). In brief ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Qinqin Fei, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... human epithelial cell (HEC) media with the supplemental kit was purchased from Cell Biologics Inc ...
-
No products found
because this supplier's products are not listed.
Rostislav Bychkov, et al.,
bioRxiv - Physiology 2020
Quote:
... The microscope was mounted on a motorized X-Y MT-2078/MT-2278 translator (Sutter Instruments). The experimental chamber with the SAN preparation was placed on a platform (Sutter Instruments ...
-
No products found
because this supplier's products are not listed.
Christoph Gerdes, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Micropipette tips were sharpened at an angle of 20-30° until the pipette tip had a syringe-like shape (Micropipette Beveler 48000; World Precision Instruments). Micropipettes were filled with 3 μl of plasmid solution/s (600 ng/μl) ...
-
No products found
because this supplier's products are not listed.
Tiechao Ruan, et al.,
bioRxiv - Genetics 2024
Quote:
... was isolated from fresh spermatozoa from the WT mice (n=3) and the Iqch KO mice (n=3) using the RNAsimple Total RNA Kit (Tiangen Biotech, China, 4992858). A Ribo-Zero™ rRNA Removal Kit (MRZPL1224 ...
-
No products found
because this supplier's products are not listed.
Qian Qin, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... MAS-Seq for 10x Single Cell 3’ kit (PacBio, cat. no. 102-659-600), and individually created oligos ...
-
No products found
because this supplier's products are not listed.
Aurelie Schwartzentruber, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The ELISA was read on a PheraStar plate reader (BMG Labtech) as per the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Susmita Khamrui, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 3-hydroxy-3-methylglutaric acid (HMG) was obtained from TCI or Cayman Chemicals.
-
No products found
because this supplier's products are not listed.
Jeremy K. Herren, et al.,
bioRxiv - Microbiology 2019
Quote:
Plasmodium screening of human subjects was done in the regions surrounding Mbita using RDT kits (SD Bioline, UK). Microscopy was carried out on RDT-positive samples to confirm the presence of P ...
-
No products found
because this supplier's products are not listed.
Daniel Wells, et al.,
bioRxiv - Genetics 2019
Quote:
... and the resulting immune antisera were tested against the recombinant antigen by ELISA (Eurogentec), and the endogenous protein in mouse testes from WT and KO mice (data not shown) ...
-
No products found
because this supplier's products are not listed.
Claudia Bartoli, et al.,
bioRxiv - Pathology 2022
Quote:
... library was prepared using the EXP-NBD103 and SQK-LSK108 kits according to the manufacturer’s instructions and starting with 3 μg of 20 kb sheared DNA (Megaruptor, Diagenode) as input ...
-
To help researchers in the global fight against the coronavirus, abm has developed an RT-qPCR...
Cat# G628,
100 Rxns/kit, please contact supplier for pricing.
Ask
Tamara Miljuš, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
For all experiments human embryonic kidney (HEK) 293SL cells84 were used and regularly tested for mycoplasma contamination (PCR Mycoplasma Detection kit, ABM, Canada). HEK293SL cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) ...
-
No products found
because this supplier's products are not listed.
Yanqi Yu, et al.,
bioRxiv - Biophysics 2021
Quote:
... 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) was purchased from Alfa Aesar (Haverhill, MA). Nigericin sodium salt was purchased from Tocris Bioscience (Minneapolis ...
-
No products found
because this supplier's products are not listed.
Kaitlyn Bacon, et al.,
bioRxiv - Bioengineering 2019
Quote:
... 3 kDa MWCO concentrator (Sartorius), and the protein concentration was estimated using a BCA assay.
-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A Mouse Relaxin-3 ELISA Kit was purchased from Signalway Antibody LLC (MD ...
-
No products found
because this supplier's products are not listed.
Hannah Donnelly, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Enzyme-linked immunosorbent assays (ELISA) was then carried out as per manufacturer’s instructions (R&D Systems, BMP-2 DuoSet ELISA kit, DY355). Briefly ...
-
No products found
because this supplier's products are not listed.
Estrela Neto, et al.,
bioRxiv - Cell Biology 2020
Quote:
... a multi-neurotrophin rapid screening ELISA kit (#BEK-2231, Tebu-bio, France) was used according to the manufacturers’ protocol ...
-
No products found
because this supplier's products are not listed.
Patrizia Murer, Louis Plüss, Dario Neri,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
Arrays of freshly frozen human colorectal tumor (37) and healthy colon tissues (3) were obtained from Amsbio. A list of the 40 different tissues ...
-
No products found
because this supplier's products are not listed.
Aileen A. Nava, et al.,
bioRxiv - Genetics 2023
Quote:
... The macros’ algorithm then performs the same tasks as commercially available quantification software like Image Studio Lite from LI-COR Biosciences 174 ...
-
No products found
because this supplier's products are not listed.
Zhijie Chen, et al.,
bioRxiv - Biophysics 2019
Quote:
... transcription was chased by adding 40 µM NTPs mix together with 50 µM of each type of 3’-deoxynucleotide RNA chain terminators (3’dATP, 3’dCTP, 3’dGTP, 3’dUTP, TriLink Biotechnologies). The reactions were allowed to proceed at room temperature for 10 min before terminated by adding the 2× urea stop buffer ...
-
No products found
because this supplier's products are not listed.
Tamas L Nagy, Jack Strickland, Orion D Weiner,
bioRxiv - Cell Biology 2023
Quote:
... Neutrophils were isolated using the EasySep Direct Human Neutrophil Isolation Kit (STEM-CELL Tech #19666) with the BigEasy magnet (STEMCELL Tech #18001 ...
-
PRG-3 and Attachment Factor™ are engineered to work together to stabilize the cell membrane and...
Cat# 4Z0-410,
100.0 mL, $82.0
Ask
Guneet Kaur, et al.,
bioRxiv - Neuroscience 2023
Quote:
Primary human cerebral cortex microvascular endothelial cells (Passage 3, 12 CPD in vitro, ACBRI 376) were procured from Cell Systems (Kirkland, WA 98034, USA). Brain microvascular endothelial cells (BMECs ...
-
No products found
because this supplier's products are not listed.
Timm O. Koller, et al.,
bioRxiv - Biochemistry 2022
Quote:
Grids (Quantifoil R3/3 Cu300 with 3 nm holey carbon) were glow discharged and 4 µL of sample (8 OD260/mL ...
-
No products found
because this supplier's products are not listed.
Kehui Xiang, David P. Bartel,
bioRxiv - Molecular Biology 2021
Quote:
... indole-3-acetic acid (IAA, GoldBio) was dissolved in ethanol and added to cells at a concentration of 0.5 mM ...