-
No products found
because this supplier's products are not listed.
Maria Körner, et al.,
bioRxiv - Cell Biology 2023
Quote:
Pulldown assays using immobilized GST fusion proteins or biotinylated peptide (Biotin- CQGLYFHINQTLREAHFHSLQHRG-COOH; PANATecs GmbH, Tübingen, Germany) were essentially performed as described (Böhm et al ...
-
No products found
because this supplier's products are not listed.
Kimberley El, et al.,
bioRxiv - Cell Biology 2023
Quote:
... levels were normalized to total protein levels (Sigma-Aldrich, #E3138, 1:1000 with Nacalai USA Signal Enhancer HIKARI), and total (i.e ...
-
No products found
because this supplier's products are not listed.
Soner Sonmezoglu, et al.,
bioRxiv - Bioengineering 2021
Quote:
... tris-(Bathophenanthroline) Ruthenium (II) Perchlorate (Ru(dpp)3(ClO4)2) (CAS 75213-31-9; GFS Chemicals), were immobilized on the surface of silica particles with a diameter of 10 µm (CAS 7631-86-9 ...
-
No products found
because this supplier's products are not listed.
Samuel X. Shi, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Brain slices (2 mm) were consecutively sectioned coronally using a stainless-steel mouse brain matrix (Roboz Surgical Instrument Co. ...
-
No products found
because this supplier's products are not listed.
Raza Ali Naqvi, Araceli Valverde, Afsar Naqvi,
bioRxiv - Immunology 2023
Quote:
... Gene expression was examined using PCR array plate containing 88 primer sets directed against human NF-κB pathway genes and 8 housekeeping primer sets (Real Time Primers, LLC Elkins Park, PA). Briefly ...
-
No products found
because this supplier's products are not listed.
Qianying Zuo, et al.,
bioRxiv - Cancer Biology 2022
Quote:
IN SITE Metastasis Kit (Xylyx Bio, Inc., NY) containing TissueSpec Bone (MTSBN101) ...
-
No products found
because this supplier's products are not listed.
Amy R. Rappaport, et al.,
bioRxiv - Immunology 2021
Quote:
... Plates were incubated with anti-nucleocapsid protein primary antibody cocktail (clones HM1056 and HM1057) (EastCoast Bio, North Berwick, ME) for 60 minutes at 37°C (Battelle Memorial Institute ...
-
No products found
because this supplier's products are not listed.
Léa Pinon, et al.,
bioRxiv - Synthetic Biology 2024
Quote:
... FujiFilm collagen I (LabChem Wako, Collagen-Gel Culturing Kit) has been used to obtain the 2.4 mg/ml solution ...
-
No products found
because this supplier's products are not listed.
Kelsey A. Haugh, et al.,
bioRxiv - Microbiology 2020
Quote:
... or permeabilized with PBS containing 0.2% Triton X-100 (for stains of intracellular proteins) and treated with Fc receptor blocker (Innovex Biosciences), Richmond ...
-
No products found
because this supplier's products are not listed.
Nishith M Shrimali, et al.,
bioRxiv - Pathology 2021
Quote:
... and incubated with collagen (10 µg/ml) or ADP (2 µM, both from the Bio/Data Corporation, USA) 10 minutes ...
-
No products found
because this supplier's products are not listed.
Matthew D. Kerr, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 1-bicyclo[2.2.1]hept-5-en-2-ylmethanamine (norbornene amine) was purchased from Matrix Scientific (# 038023, lot: M15S). Cy5-tetrazine amine was purchased from Lumiprobe (lot ...
-
No products found
because this supplier's products are not listed.
Arthur J. Jallet, Arnaud Le Rouzic, Anne Genissel,
bioRxiv - Evolutionary Biology 2019
Quote:
... 50 mL of frozen cell suspension were lyophilized for 3 days (LYOVACTM GT 2-E freeze dryer, Steris) and ground in liquid nitrogen to a fine powder with a mortar and pestle ...
-
No products found
because this supplier's products are not listed.
Jessica L. Kelliher, et al.,
bioRxiv - Microbiology 2023
Quote:
... Endpoint kinase assays were performed by mixing 3 μg purified PrkA1- 338 with the indicated combinations of ∼3x molar excess of substrate to kinase (6 μg of the generic kinase substrate myelin basic protein [MBP; Novatein Biosciences, Woburn ...
-
No products found
because this supplier's products are not listed.
Elisa M Nabel, et al.,
bioRxiv - Neuroscience 2020
Quote:
Mice were anesthetized with 2% isoflurane and head-fixed on in a mouse stereotactic apparatus (Narishige International USA Inc.) equipped with a heating pad ...
-
No products found
because this supplier's products are not listed.
J. Ibáñez, et al.,
bioRxiv - Neuroscience 2020
Quote:
... bipolar EMG from the TA was recorded with two surface Ag-AgCl electrodes 2 cm apart (WhiteSensor 40713, Ambu). The ground electrode was placed on the right ankle ...
-
No products found
because this supplier's products are not listed.
Charles E. Mackay, et al.,
bioRxiv - Physiology 2021
Quote:
... Arterial segments 1-2 mm in length were cannulated at each end in a perfusion chamber (Living Systems Instrumentation) continuously perfused with PSS and maintained at 37°C ...
-
No products found
because this supplier's products are not listed.
Gregory M Wright, et al.,
bioRxiv - Cell Biology 2023
Quote:
... FISH was performed using probes for the MT locus in 16q12.2 (56,396,107 to 56,782,063 on chromosome 16 in GRCh37) and chromosome 16 α-satellite purchased from Oxford Gene Technology, who performed paired-end sequencing to verify the identity of the BACs ...
-
No products found
because this supplier's products are not listed.
Biswapriya Biswavas Misra, et al.,
bioRxiv - Systems Biology 2019
Quote:
... A high-sensitivity assay kit (Kamiya Biomedical, Seattle, WA, USA), with a latex particle-enhanced immunoturbidometric method ...
-
No products found
because this supplier's products are not listed.
Neil J Rzechorzek, et al.,
bioRxiv - Biochemistry 2020
Quote:
... HEK293-F cells were grown in 400 mL batches in 2 L non-baffled Erlenmeyer flasks (TriForest Enterprises Inc, #FPC2000S) to a cell density of ∼1×106 cells/mL.
-
No products found
because this supplier's products are not listed.
Jared O. Kroll, et al.,
bioRxiv - Biochemistry 2023
Quote:
... streptavidin enrichment and tryptic digestion were performed as previously described.58 Peptides (25 μL) were transferred to 200 μL volume AQ brand silanized glass vial inserts in 2 mL glass autosampler vials (MicroSolv) and stored at −20 °C.
-
No products found
because this supplier's products are not listed.
Jared M. Fischer, et al.,
bioRxiv - Bioengineering 2024
Quote:
... whole blood (10 µL) was mixed with 2 mM EDTA (10 µL) and analyzed using the HemaVet 950S (Drew Scientific).
-
No products found
because this supplier's products are not listed.
David Jukam, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Eggs were irradiated by placing the 6 cm petri dish in a dark chamber for 2 minutes under a 500 Watt Hg arc lamp (Oriel Instruments) producing a downward facing focused beam with diameter of ∼8 cm such that every egg in the dish was covered by the UV light ...
-
No products found
because this supplier's products are not listed.
Christopher D. Pull, et al.,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
We measured the foraging success of individual bees on exiting and re-entering the colony using weight-averaging scales for moving subjects (mean of three repeat measurements with 2s averaging and accuracy of ± 2 mg; Advanced portable balance Scout STX123 120g; OHAUS Corporation) and their lifetime foraging activity and survival using an RFID system (MicroSensys GmBH ...
-
No products found
because this supplier's products are not listed.
Sara Castagnola, et al.,
bioRxiv - Genomics 2020
Quote:
... was performed before cutting the brains sagittally in six equally thick sections (2 mm) using a mouse brain matrix slicer (CellPoint Scientific) and 5 razorblades ...
-
No products found
because this supplier's products are not listed.
Shuyong Jia, et al.,
bioRxiv - Bioengineering 2020
Quote:
... The classic LDFs of both control points (points 1 and 2) were recorded by a PeriFlux 5000 (Perimed AB, Stockholm, Sweden) system with a 64-Hz sampling rate ...
-
No products found
because this supplier's products are not listed.
Eric Esposito, et al.,
bioRxiv - Cell Biology 2021
Quote:
... The RNA was further purified by twice mixing the aqueous supernatant with 700 μL of acidic phenol chloroform and centrifuging the solution in a 5Prime Phase Lock Gel Heavy 2 ml tube (Andwin Scientific) at 16,000 rcf to separate the phases ...
-
No products found
because this supplier's products are not listed.
Shengyun Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...
-
No products found
because this supplier's products are not listed.
Anne-Stéphanie Rueff, et al.,
bioRxiv - Microbiology 2023
Quote:
... bacteria were harvested at OD595nm of 0.1 and incubated with 1/1000 of Pneumococcus type 2 Rabbit antiserum (SSI Diagnostica, 16745) for 5 min on ice ...
-
No products found
because this supplier's products are not listed.
Dennis Alejandro Escolástico-Ortiz, et al.,
bioRxiv - Microbiology 2023
Quote:
... followed by 1 h at 45°C and 2 h at 65°C in a heating block digestion system (DigiPREP, SCP Sciences). After digestion ...
-
No products found
because this supplier's products are not listed.
Anne Tersteegen, et al.,
bioRxiv - Immunology 2021
Quote:
Total DNA was isolated from tissues using a DNA isolation kit (Genekam) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Nora Hartig, Kathrin M. Seibt, Tony Heitkam,
bioRxiv - Plant Biology 2022
Quote:
... PCR products were purified (As One International,Invisorb Spin DNA Extraction Kit) and ligation into pGEM-T plasmids (ThermoFisher Scientific ...
-
No products found
because this supplier's products are not listed.
Victoria E. Brings, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... the surface of the right hind paw was sterilized and a 5-mm incision was made through the skin starting 2 mm from the heel using a type 11 scalpel blade (McKesson, Richmond, VA). The flexor digitorum brevis muscle was pulled up to isolate ...
-
No products found
because this supplier's products are not listed.
Dominique Vanhecke, Viola Bugada, Thorsten Buch,
bioRxiv - Animal Behavior and Cognition 2023
Quote:
... Both MOE and SOE emulsions were freshly made on the day of treatment by emulsification during 10 minutes at room temperature using 2 mL Luer-Lock syringes (Braun # 4606701V) connected with a one-way Luer female to female adaptor (Cadence Science #6521IND).
-
No products found
because this supplier's products are not listed.
Blanca M. Perez-Sepulveda, et al.,
bioRxiv - Microbiology 2020
Quote:
... selecting either a “scoop” with a 10 μL plastic loop taken from a bacterial glycerol (50% v/v) stock or 2 beads of bacteria stored at −80°C in a Microbank tube™ cryotubes (Pro-Lab Diagnostics). The samples were grown at 37°C and 220 rpm overnight in either 100 or 200 μL LB (1% tryptone ...
-
No products found
because this supplier's products are not listed.
Roberto Balbontín, Nelson Frazão, Isabel Gordo,
bioRxiv - Microbiology 2020
Quote:
... In the competitions including the RNase HI inhibitor 2-[[[3-Bromo-5-(2-furanyl)-7-(trifluoromethyl)pyrazolo[1,5-a]pyrimidin-2-yl]carbonyl]amino]-4,5,6,7-tetrahydro-benzo[b]thiophene-3-carboxylic acid ethyl ester (RHI001, Glixx Laboratories Inc., catalog number GLXC-03982), the medium was supplemented with 500 µM of RHI001 ...
-
No products found
because this supplier's products are not listed.
Chan Cao, et al.,
bioRxiv - Biophysics 2023
Quote:
... EBCs were lysed and further treated using the Hemovoid kit (Biotech Support Group), aiming to remove hemoglobin (the most abundant protein in RBCs ...
-
No products found
because this supplier's products are not listed.
Tyler P. Nicholas, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... or to silver nanoparticles (AgNP; 20 nm, gold-core, citrate-coated, at 1 mg/mL in 2 mM sodium citrate; nanoComposix, San Diego, CA, USA) for an acute exposure of 24 hours ...
-
No products found
because this supplier's products are not listed.
Benedict Edward Mc Larney, et al.,
bioRxiv - Cancer Biology 2022
Quote:
The fluorescence emission spectra of pHLIP ICG was assessed in the presence of and without POPC (1-Palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine) liposomes (100nm in size, T&T Scientific Corp, TN, USA). pHLIP ICG has previously shown a high NIR fluorescent state when bound to liposomes and low NIR fluorescent state without the presence of liposomes enabling in vitro testing.(47 ...
-
No products found
because this supplier's products are not listed.
Carmen RB da Silva, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... The volumetric flow rates produced by the flow controllers was measured using a Gilian Gilibrator–2 NIOSH Primary Standard Air Flow Calibrator with a low–flow cell (Sensidyne, LP, St Petersburg, FL, USA) and corrected to standard temperature pressure ...
-
No products found
because this supplier's products are not listed.
Lebogang N. Maruma, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Cell Signalling Technology antibodies and Promega luminometry kits were procured from Anatech (Johannesburg, South Africa). All other reagents were purchased from Merck (Darmstadt ...
-
No products found
because this supplier's products are not listed.
Bapi Biswas, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... donovani amastigotes in whole lysate was checked by Lipase Assay Kit (REAlGENE, US, Cat # 250069) expressed in Unit/μg ...
-
No products found
because this supplier's products are not listed.
Walker D. Short, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... HA concentration was confirmed in the extracted samples with a Hyaluronic Acid test kit (Corgenix Specialists in ELISA & IVD Diagnostic Technology ...
-
No products found
because this supplier's products are not listed.
Yuqian Jiang, et al.,
bioRxiv - Bioengineering 2020
Quote:
... A temperature-controlled oil bath (Instatherm® Economy Bath/Controller Kit, Ace Glass, Inc., VWR, USA) equipped with a type J thermocouple temperature sensor was employed to control the heat treatment temperature ...
-
No products found
because this supplier's products are not listed.
Nathan W. Zammit, et al.,
bioRxiv - Immunology 2019
Quote:
... Cells were lysed and adenoviruses were extracted using Aenopure kit according to instructions provided (PureSyn Inc.). The purified virus was titrated and quantified in HEK293 cells using the Adeno-X Rapid Titer Kit (clontech ...
-
No products found
because this supplier's products are not listed.
Veronica Ferrucci, et al.,
bioRxiv - Genetics 2020
Quote:
... Real-time RT-PCR was performed using ‘RealQquality RQ-2019-nCoV’ kits (Ab Analitica; IVD approved) for detection of the RdRp and E genes (from the SarsCov2 N gene) ...
-
No products found
because this supplier's products are not listed.
Kristina Haslinger, et al.,
bioRxiv - Biochemistry 2020
Quote:
... we used the TR-FRET Bridge-It® S-Adenosyl Methionine (SAM) Fluorescence Assay Kit from Mediomics LLC (St ...
-
No products found
because this supplier's products are not listed.
Bettina Budeus, et al.,
bioRxiv - Immunology 2022
Quote:
... IGHV gene rearrangements were amplified using the LymphoTrack IGH FR1 Assay kit (InvivoScribe, San Diego, CA, USA). Amplified DNA was processed for HTSeq according to the LymphoTrack protocol ...
-
No products found
because this supplier's products are not listed.
Rosalia Emma, et al.,
bioRxiv - Biochemistry 2022
Quote:
... the bacterial suspensions were immediately used for AMES screening by following manufacturer’s protocol (Salmonella Mutagenicity Test Kit, MOLTOX®). Briefly ...
-
No products found
because this supplier's products are not listed.
Benjamin Abrams, et al.,
bioRxiv - Cell Biology 2022
Quote:
All study participants received a sample kit which included: 1) 500 µL of CyGELTM mounting media (BioStatus Ltd., Cat# Cy10500), 2 ...
-
No products found
because this supplier's products are not listed.
Christopher A. Hempel, et al.,
bioRxiv - Genomics 2022
Quote:
DNA and total RNA were separately extracted from samples in 96-well plates using the NucleoMag DNA/RNA Water kit (D-MARK Biosciences, Toronto, Canada) that includes magnetic beads ...