-
No products found
because this supplier's products are not listed.
Ariane C. Scheuren, et al.,
bioRxiv - Physiology 2020
Quote:
... Markers for bone formation and resorption were measured in technical duplicates using ELISA kits for N-terminal propeptide of type I procollagen (PINP, AC-33F, Immunodiagnostics) and for C-terminal cross-linked telopeptides of type I collagen (CTX-I ...
-
No products found
because this supplier's products are not listed.
Bas W.A. Bögels, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide HCl (EDC, Carbosynth), 1,6-diaminohexane (Sigma ...
-
No products found
because this supplier's products are not listed.
Donggi Paik, et al.,
bioRxiv - Immunology 2021
Quote:
... 3-oxoLCA (Steraloids (C1750-000 ...
-
No products found
because this supplier's products are not listed.
Zhexin Wang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 3 times at 10,000 rpm for 5 s (IKA TC10 basic ULTRA-TURRAX® homogenizer with S10N-5G dispersing element ...
-
No products found
because this supplier's products are not listed.
MR Melo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rats were transferred to a stereotaxic frame (incisor bar +3 mm; RWD Life Science). To perform the optogenetic experiments ...
-
No products found
because this supplier's products are not listed.
Kathleen M.E. Gallagher, et al.,
bioRxiv - Immunology 2021
Quote:
A qualitative ELISA for Human Anti-IgG/A/M SARS-CoV-2 ELISA (The Binding Site) was performed using donor serum per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Rosalie Martel, et al.,
bioRxiv - Bioengineering 2022
Quote:
Antibody microarrays were patterned on PolyAn 2D-Aldehyde slides (PolyAn) using the sciFLEXARRAYER SX inkjet bioprinter (Scienion). Slide were imaged in the 532 nm channel at 100% gain prior to patterning to qualitatively assess the uniformity of the aldehyde functionalization ...
-
No products found
because this supplier's products are not listed.
Mizuho Nosaka, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... tPA (Mouse tPA ELISA Kit, PA92, Oxford Biomedical Research, Rochester Hills, MI), uPA (Active mouse uPA Functional Assay Kit ...
-
No products found
because this supplier's products are not listed.
Magdalena Malm, et al.,
bioRxiv - Systems Biology 2021
Quote:
... The expression of THBS4 in each sample was evaluated by sandwich ELISA using a human anti-HPC4-antibody (Icosagen) as capture antibody ...
-
No products found
because this supplier's products are not listed.
Swayam Prakash Srivastava, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Urine albumin levels were assayed using a Mouse Albumin ELISA Kit (Exocell, Philadelphia, PA).
-
No products found
because this supplier's products are not listed.
Carina C D Joe, et al.,
bioRxiv - Bioengineering 2021
Quote:
Residual host-cell protein (HCP) was quantified using the HEK293 HCP ELISA kit (Cygnus Technologies) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Noelia Perez Diaz, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... bronchi and parenchyma from naïve rats was measured using Rat PPARβ/δ ELISA kit (Abbkine) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Nigel Dao, Dakota F. Brockway, Nicole A. Crowley,
bioRxiv - Neuroscience 2019
Quote:
... 3×50 uL of the aCSF within the well was pipetted into a 96-well SST ELISA plate (Peninsula Labs, cat. #S-1179) as per the manufacturer’s instruction ...
-
No products found
because this supplier's products are not listed.
Xian Zhou, et al.,
bioRxiv - Immunology 2020
Quote:
... Human B cell proliferation was measured by 3[H]-thymidine incorporation (1 μCi/mL) (American Radiolabeled Chemicals).
-
No products found
because this supplier's products are not listed.
Robert J. Fialkowski, et al.,
bioRxiv - Physiology 2022
Quote:
Oxidative DNA damage was evaluated for 8-OhDG damage using a DNA damage ELISA kit (StressMarq Biosciences Inc.) (Fialkowski et al. ...
-
No products found
because this supplier's products are not listed.
Syed Moiz Ahmed, et al.,
bioRxiv - Cancer Biology 2019
Quote:
Endogenous TOP1cc were detected by Human Topoisomerase ICE kit (Topogen, TG1020-0) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Sarah M. Mohr, et al.,
bioRxiv - Physiology 2024
Quote:
... T3 concentration was measured by ELISA (Leinco Technologies, T181). Dried product was resolubilized in the zero-standard and the kit run according to the manufacturer’s instructions.
-
This kit is a sandwich ELISA assay for the quantitative measurement of ALDH2 in Human serum,...
Cat# KITE1076,
Inquiry
Ask
Ilaria Frasson, et al.,
bioRxiv - Microbiology 2023
Quote:
... We conducted genome-wide negative selection (dropout) screens in Cas9-Calu-3 cells by using the human GeCKO v2 library (Creative Biogene, cat. CCLV0001) that targets 18823 genes with 6 gRNAs/gene as well as 1000 non-targeting gRNAs ...
-
No products found
because this supplier's products are not listed.
Stephanie Dobersch, et al.,
bioRxiv - Molecular Biology 2020
Quote:
Hydroxyproline levels in human lung fibroblasts were determined using the QuickZyme Hydroxyproline Assay kit (Quickzyme Biosciences). The cells and lung tissue were separately homogenized in 1 ml 6 N HCl with a Precellys tissue homogenizer (2 × 20 s ...
-
Anti-idiotypic (anti-aflatoxin B1) antibody is a recombinant protein produced in E. coli.
Cat# NABG-001,
Inquiry
Ask
Christopher J. Minteer, et al.,
bioRxiv - Cancer Biology 2022
Quote:
3 primary human astrocyte cell lines were derived from the cerebral cortex of one 21-year-old male donor (Creative Biolabs, #NCL-2103-P104). The 21M donor was split into Astro1 ...
-
No products found
because this supplier's products are not listed.
Min Pan, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Cas9 activity was tested using the CRISPRtest™ Functional Cas9 Activity Kit for Human Cells (Cellecta, #CRTEST). The clone with normal viability and high Cas9 activity (> 95% ...
-
No products found
because this supplier's products are not listed.
Maria E. Candela, et al.,
bioRxiv - Immunology 2021
Quote:
Treatments with HBD3 peptide(s) was after 15-30 minutes 5 μg/ml of human β-Defensin-3 (hBD3) (Peptide Institute Inc., PeptaNova GmbH #4382-s), or 5 μg/ml of Linear Defensin (Almac Sciences Scotland Ltd ...
-
No products found
because this supplier's products are not listed.
Wren E. Michaels, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Cell lysates were prepared and diluted to 3 mg/ml using the sample preparation kit (Protein Simple) for an automated capillary western blot system ...
-
No products found
because this supplier's products are not listed.
Balaji Karthick Subramanian, et al.,
bioRxiv - Pathology 2019
Quote:
... Human primary podocytes from Celprogen Inc ...
-
No products found
because this supplier's products are not listed.
Alexa Schuettenberg, et al.,
bioRxiv - Immunology 2022
Quote:
... normal human IgG (ProSci #5503) on each plate as a positive control ...
-
No products found
because this supplier's products are not listed.
Naomi R. Shvedov, et al.,
bioRxiv - Neuroscience 2023
Quote:
... a 3 mm diameter round coverglass (3 mm circular, #1, Thomas Scientific), bonded to a stainless steel cannula (304 S/S Tubing .125” OD x .115” ID x 0.019” ...
-
No products found
because this supplier's products are not listed.
Manuel Göpferich, et al.,
bioRxiv - Neuroscience 2020
Quote:
... human FGF (20 ng/μl, ReliaTech) and human EGF (Promokine) ...
-
Magnetofection
diificult to transfect cells
Cat# KM30350,
SilenceMag 200µL + CombiMag 100µL, USD $186.00/KIT
Ask
Alexandra Grubman, et al.,
bioRxiv - Neuroscience 2019
Quote:
... were transfected for 48 h with dox-inducible GFP-tagged Gateway-generated Piggybac expression constructs with inserted cDNA encoding human HIF1A and/or ELF3 open reading frames using Glial Mag transfection kit (Oz Biosciences, #GL00500) according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Tobias Tertel, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 12 nM anti-human CD63 PE (EXBIO) or 13 nM anti-human CD81 PE (Beckman Coulter) ...
-
No products found
because this supplier's products are not listed.
Nazila V. Jafari, Jennifer L. Rohn,
bioRxiv - Microbiology 2022
Quote:
HBLAK human bladder progenitor cells (CELLnTEC, Switzerland) were grown according to the CELLnTEC protocol ...
-
No products found
because this supplier's products are not listed.
Megan L. Schaller, et al.,
bioRxiv - Physiology 2024
Quote:
... Samples were incubated in 3% acetic acid for 3 minutes followed by Alcian Blue (Newcomer Supply, 1003A) for 30 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Aly Elezaby, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Serum lactate dehydrogenase level was measured at 3 days after MI by commercially available kit following manufacturer’s instructions (Eton Bioscience, San Diego, CA, USA). Fractional shortening was determined under basal conditions and after isoproterenol stimulation (10μg/kg ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Nobunao Ikewaki, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... 3’-diaminobenzidine/H2O2 solution (Nichirei Bioscience Inc., Japan). The primary antibody used was monoclonal antibody to mouse macrophages (BMA Biomedicals ...
-
No products found
because this supplier's products are not listed.
Romina Ulloa, et al.,
bioRxiv - Cell Biology 2021
Quote:
... ∼2 × 107 3-μm latex NH2-beads (Polyscience) were activated with 8% glutaraldehyde for 4 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Greg Tram, et al.,
bioRxiv - Microbiology 2019
Quote:
... 3 µm particle size (Tosoh Biosciences, Tokyo, Japan). Samples were resuspended in buffer B (90% MeCN / 0.1% TFA ...
-
No products found
because this supplier's products are not listed.
Molly Ohainle, et al.,
bioRxiv - Microbiology 2019
Quote:
... supplemented with 5% heat-inactivated human AB+ serum (Omega Scientific), 20 mM GlutaMAX-I ...
-
No products found
because this supplier's products are not listed.
Huu Tuan Nguyen, et al.,
bioRxiv - Bioengineering 2023
Quote:
Human umbilical vein endothelial cells (ECs, Angio-Proteomie, MA, USA) were cultured in Vasculife (LifeLine Cell Technology ...
-
No products found
because this supplier's products are not listed.
Pavan Nayak, Arul Subramanian, Thomas Schilling,
bioRxiv - Developmental Biology 2022
Quote:
... using a BeadBug 3 Microtube Homogenizer D1030 (Benchmark Scientific), and RNA was extracted using Trizol according to the standard protocol (Invitrogen 15596018) ...
-
No products found
because this supplier's products are not listed.
Carlos A. Sánchez-León, et al.,
bioRxiv - Neuroscience 2020
Quote:
... a polyethylene tubing (3 mm inner diameter; A-M Systems), which acted as the active electrode for tRNS ...
-
No products found
because this supplier's products are not listed.
Catherine S. Liou, et al.,
bioRxiv - Microbiology 2024
Quote:
... Human commensal type strains were grown on either Brain Heart Infusion (Teknova) agar plates supplemented with 5 μg/mL hemin and 0.5 μg/mL menadione (BHIS ...
-
No products found
because this supplier's products are not listed.
Jiajie Xu, Juan J.L. Guzman, Largus T. Angenent,
bioRxiv - Bioengineering 2020
Quote:
... The increased solution volume in chamber #3 was pumped (Cole-Parmer L/S Digital Economy Drive ...
-
No products found
because this supplier's products are not listed.
Jiahn Choi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 3′-diaminobenzidine (DAB) for visualization of the antigen-antibody complex (Scytek).
-
No products found
because this supplier's products are not listed.
Matthias Schmidt, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and 3-hydroxy-2,4-dimethylhexanoic acid were synthesized by Enamine (Ukraine).
-
No products found
because this supplier's products are not listed.
Lisa Duvick, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 3-dimensional CT images were analyzed using Imaris 9.8 (Oxford Instruments). Kyphosis index was determined based on where the distance is calculated from a horizontal line drawn from the center of the C7 vertebrae to the center of the pelvis ...
-
No products found
because this supplier's products are not listed.
Kosuke Fukui, et al.,
bioRxiv - Plant Biology 2021
Quote:
... and desalted by Spectra/Por® Dialysis Membrane 3 (Spectrum Labs, USA) with Buffer IV (10 mM NaCl ...
-
No products found
because this supplier's products are not listed.
Sebastián Cerminati, et al.,
bioRxiv - Bioengineering 2021
Quote:
Fed-batch fermentations were carried out in 3 L (New Brunswick Bio Flo 115, USA) fermenters ...
-
No products found
because this supplier's products are not listed.
Zhaoyang Liu, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Histological analysis was performed on thoracic spines fixed in 10% neutral-buffered formalin for 3 days at room temperature followed by 1-week decalcification in Formic Acid Bone Decalcifier (Immunocal, StatLab). After decalcification ...
-
No products found
because this supplier's products are not listed.
Ankita B. Jaykumar, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... and mycoplasma-free (e-Myco Kit, Boca Scientific or Universal Mycoplasma Detection Kit 30-1012K ...
-
No products found
because this supplier's products are not listed.
Mengdi Yang, et al.,
bioRxiv - Bioengineering 2022
Quote:
... RNA was extracted by RNApure Tissue & Cell Kit (CoWin Biosciences, CW0560S) as manufacturer’s instructions except for DNase I treatment ...