-
No products found
because this supplier's products are not listed.
Lukas Babylon, Julia Meißner, Gunter P. Eckert,
bioRxiv - Neuroscience 2023
Quote:
... Aβ1-40 was determined using an HTRF amyloid beta 1-40 kit (Cisbio, Codolet, France). The protocol has been described previously [42] ...
-
No products found
because this supplier's products are not listed.
Austin J. Graham, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... isopropyl β-D-1-thiogalactopyranoside (IPTG, Teknova), kanamycin sulfate (C18H38N4O15S ...
-
No products found
because this supplier's products are not listed.
Supawadee Umthong, et al.,
bioRxiv - Microbiology 2023
Quote:
... rat anti-MLV p15E (clone 42/114; Kerafast), rat anti-MLV p30 (R187 ...
-
No products found
because this supplier's products are not listed.
Theodora Chalatsi, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Toptica MLE) and a detection path comprising a 42 Olympus MVX-10 zoom macroscope with a 1× objective (Olympus MVPLAPO 1×), a filter wheel (Ludl 96A350) ...
-
No products found
because this supplier's products are not listed.
Mengyuan Xu, et al.,
bioRxiv - Biophysics 2023
Quote:
Three microliters of the purified CLC-2 or CLC-2/AK-42 mixture was applied to glow-discharged copper Quantifoil R1.2/1.3 or R2/1 holey carbon grids (Quantifoil). Grids were incubated for 15 s ...
-
No products found
because this supplier's products are not listed.
Joseph Hiatt, et al.,
bioRxiv - Genetics 2020
Quote:
... 1% Human AB Serum (Valley Biomedical HP1022HI), Penicillin-Streptomycin (100IU and 100µg/mL ...
-
No products found
because this supplier's products are not listed.
Bright Obeng, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Fluorescence intensity was measured every 42 seconds for a duration of 1 hour at 37°C with a plate reader (Synergy 2, Biotek) (Temperature 37°C ...
-
No products found
because this supplier's products are not listed.
Natasha S. Kelkar, et al.,
bioRxiv - Immunology 2023
Quote:
... 1:300 dilution of ms-anti-human-C3b (Cedarlane Labs, CL7636AP) was added as primary antibody while goat anti-ms-IgG-PE ...
-
No products found
because this supplier's products are not listed.
Tyler N. Starr, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... Recombinant human ACE2 (Uniprot: Q9BYF1-1) was purchased from ACROBiosystems (AC2-H82E6), consisting of residues 18-740 spanning an intrinsic dimerization domain ...
-
No products found
because this supplier's products are not listed.
Katerina Konstantoulea, et al.,
bioRxiv - Neuroscience 2021
Quote:
10uM of monomeric Biot-Aβ1-42 in 50mM Tris pH7.4 was pipetted to μclear medium binding half area plates (Greiner, #675096) and ThT was added to a final concentration of 25 μM ...
-
No products found
because this supplier's products are not listed.
Silvia Benito-Kwiecinski, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
RNA from all 42 samples was isolated in parallel with the Direct-zol-96 RNA kit (Zymo Research, R2055), following the product’s manual ...
-
No products found
because this supplier's products are not listed.
Jan Steinkühler, et al.,
bioRxiv - Biophysics 2020
Quote:
... Human Transferrin – CF488A (Biotium) at 130 nM ...
-
No products found
because this supplier's products are not listed.
Nicole A. Ellis, et al.,
bioRxiv - Genetics 2023
Quote:
... coli GC5 (Genesee Scientific 42-650) with selection on LB+Kan (30 µg/mL ...
-
No products found
because this supplier's products are not listed.
John Kim, et al.,
bioRxiv - Cell Biology 2023
Quote:
... rabbit anti-β-Tubulin (1:5000, Absolute Antibody), rabbit anti-COXIV (1:1000 ...
-
No products found
because this supplier's products are not listed.
Anzela Niraula, et al.,
bioRxiv - Physiology 2021
Quote:
... and rabbit anti-β-endorphin (Phoenix Pharmaceuticals, 1:5000). Washes were performed followed by subsequent incubations with secondary antibodies ...
-
No products found
because this supplier's products are not listed.
Júlia T. Oliveira, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and mouse anti-β-Tub III/Tuj 1 (1:4000, MO15013, Neuromics). The secondary antibodies used were ...
-
No products found
because this supplier's products are not listed.
James Varani, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... interleukin 1-β (IL-1ß; 25 ng/mL, Shenandoah Biotech), and interferon-γ (IFN-γ ...
-
No products found
because this supplier's products are not listed.
Godfried Dougnon, et al.,
bioRxiv - Neuroscience 2024
Quote:
Male mice received intraperitoneal injections of 200 mg.kg-1 etoposide (CAS no. 33419-42-0, Tokyo Chemical Industry) dissolved in 5% DMSO/PBS ...
-
No products found
because this supplier's products are not listed.
I. Rhim, I. Nauhaus,
bioRxiv - Neuroscience 2021
Quote:
... Addgene viral prep # 100837-AAV1)42 was delivered using a Picospritzer III (Parker) or Nanoliter injector (WPI) to 2-3 sites in V1 with 0.25-0.5ul per site ...
-
No products found
because this supplier's products are not listed.
Charlie J. Childs, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Human Fibrinogen 1 Plasminogen Depleted (Enzyme Research Lab Cat#FIB-1), and X-Vivo 20 (Lonza Cat#190995) ...
-
No products found
because this supplier's products are not listed.
Alexandru-Ioan Voda, et al.,
bioRxiv - Genomics 2023
Quote:
... Human Anti-CD27 agonist antibody (100111-1, AMSBio) and Mouse Anti-CD6 agonist antibody (Clone UMCD6 ...
-
No products found
because this supplier's products are not listed.
Damian Dudka, R. Brian Akins, Michael A. Lampson,
bioRxiv - Cell Biology 2023
Quote:
... Centromeres were labeled with CREST (human anti-human Anti-Centromere Antibody, 1:200, Immunovision, HCT-0100) and an Alexa Fluor 594–conjugated goat anti-human secondary antibody (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Jan Clement Santiago, et al.,
bioRxiv - Microbiology 2020
Quote:
... 1 ng human genomic DNA (Bioline, Cat. # BIO-35025) was used as negative control ...
-
No products found
because this supplier's products are not listed.
Gregory S. Bulmer, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The following substrates were used: pNP-β-D-galactofuranoside (pNP-β-D-Galf; Carbosynth), pNP-α-ʟ-arabinofuranoside (pNP-α-ʟ-Araf ...
-
No products found
because this supplier's products are not listed.
Helen W. Liu, et al.,
bioRxiv - Plant Biology 2024
Quote:
... and CF1 α/β 1:50,000 (Merchant and Selman 1983, Agrisera AB AS03 030). The membranes were subsequently washed once for 15 min ...
-
No products found
because this supplier's products are not listed.
Nagham Alouche, et al.,
bioRxiv - Immunology 2019
Quote:
... 50μM β-mercaptoethanol (PAN biotech), 1mM sodium pyruvate (Gibco ...
-
No products found
because this supplier's products are not listed.
Michael A. Tartell, et al.,
bioRxiv - Microbiology 2020
Quote:
HeLa cells were pretreated with 500 U ml−1 IFN-β (Tonbo Biosciences 21-8699) or vehicle (0.1% BSA ...
-
No products found
because this supplier's products are not listed.
Bing Han, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
No products found
because this supplier's products are not listed.
James R Anderson, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... 42 and 63 days were concentrated using 2 ml Vivaspin concentrator columns (Sartorius, Göttingen, Germany) by centrifuging at 1,000g until the final volume was 100 μl and subsequently centrifuged into the column cap at 4,000g for 2 min ...
-
No products found
because this supplier's products are not listed.
Hilal Yeter-Alat, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Blots were washed two times at 42°C with 2X SSC buffer (Euromedex, Souffelweyersheim, France) with 0.1% SDS added ...
-
No products found
because this supplier's products are not listed.
Chenjie Xia, et al.,
bioRxiv - Pathology 2023
Quote:
... β-cateninCol2ER mice and β-cateninOsxER mice were viewed under a stereomicroscope (Model C-DSD230, Nikon, Japan) to assess their appearance characteristics ...
-
No products found
because this supplier's products are not listed.
Jason Wallach, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and a Venus-tagged N-terminal β-arrestin2 using 3:1 ratio of TransiT-2020 (Mirus). 5-HT2A receptor mutants were designed and performed using Q5 mutagenesis kit (New England Biolabs) ...
-
No products found
because this supplier's products are not listed.
Lukas Scheiderer, et al.,
bioRxiv - Biophysics 2023
Quote:
... pH 7.4) with 1 mM guanosine-5’-[(α,β)-methyleno]triphosphate (GMPCPP; NU-405S, Jena Bioscience) and the solution was incubated for 30 min at 37°C ...
-
No products found
because this supplier's products are not listed.
Ling Ning Lam, et al.,
bioRxiv - Microbiology 2021
Quote:
... and inoculated at a ratio of 1:1000 into pooled human serum or pooled human urine (both purchased from Lee Biosolutions). At selected time points ...
-
No products found
because this supplier's products are not listed.
Marija Dargyte, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Gel containing RNA was incubated overnight at 42°C in elution buffer (0.3M NaOAc pH 5.5, 2% SDS). RNA was ethanol precipitated and stored at -20°C until use.
-
No products found
because this supplier's products are not listed.
Kevin P. Foley, et al.,
bioRxiv - Physiology 2020
Quote:
... Human insulin (Mercodia) and human C-peptide (Millipore ...
-
No products found
because this supplier's products are not listed.
Birthe Tegtmeyer, et al.,
bioRxiv - Immunology 2021
Quote:
... or RA1 buffer supplemented with β-mercaptoethanol (Macherey-Nagel). All samples were stored at -80°C until processing ...
-
No products found
because this supplier's products are not listed.
Dennis J. Doorduijn, et al.,
bioRxiv - Microbiology 2021
Quote:
... for C5b6 with 1:500 dilution of goat-anti human C5 serum (Complement Technology) and for sMAC with 1 µg/ml biotinylated monoclonal anti-C7 (clone F10 ...
-
No products found
because this supplier's products are not listed.
Leanne E. Wybenga-Groot, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and 0.5 mM Na3VO4) at rt for 5-10 min before addition of master mix (42 pmol E1 (UBE1, Boston Biochem or Ubiquitin-Proteasome Biotechnologies) ...
-
No products found
because this supplier's products are not listed.
Sakthi Rajendran, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... tissues from secondary GBM (Grade III (n=44), Grade IV (n=23)) and LGG (grade II, n=42) using MasterPure kit (Epicentre). Raw reads from the RNA-seq data were processed using an in-house pipeline that uses STAR for read alignment ...
-
No products found
because this supplier's products are not listed.
Arya Y. Nakhe, et al.,
bioRxiv - Physiology 2024
Quote:
... β-cell Vm recordings were analyzed using ClampFit (Molecular Devices), Excel (Microsoft Corp. ...
-
No products found
because this supplier's products are not listed.
Emmanuel Martin, Magali Suzanne,
bioRxiv - Developmental Biology 2022
Quote:
... steered by a galvanometer-based laser scanning device (DPSS-532 and UGA-42, from Rapp OptoElectronic, Hamburg, Germany) and mounted on a LSM880 confocal microscope (Carl Zeiss). The microscope was fitted with a 63x C-Apochromat NA 1.2 Water Corr objective (Carl Zeiss) ...
-
No products found
because this supplier's products are not listed.
Redouane Aherrahrou, et al.,
bioRxiv - Genetics 2023
Quote:
... Human aortic SMCs (Cell Applications, Inc. ...
-
No products found
because this supplier's products are not listed.
Baishakhi Ghosh, et al.,
bioRxiv - Cell Biology 2021
Quote:
Primary non-diseased human bronchial epithelial (NHBE) and COPD human bronchial epithelial (CHBE) cells were purchased from MatTek Life Sciences (Ashland ...
-
No products found
because this supplier's products are not listed.
S. Jordan Kerns, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Human alveolar epithelial cells (Cell Biologics, Accegen) were cultured using SABM medium (Lonza ...
-
No products found
Katharina M. Eyme, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... human recombinant EGF (20 ng/mL; ABM), and human recombinant bFGF-2 (10ng/mL ...
-
No products found
because this supplier's products are not listed.
Ricardo da Silva Antunes, et al.,
bioRxiv - Immunology 2023
Quote:
... in 5% human serum (Gemini Bio-Products) for 24 h ...
-
PRG-1 (EDTA -dPBS Solution) prepares the cells for PRG-2 (containing Trypsin) processing. Cell...
Cat# 4Z0-610,
100.0 mL, $68.0
Ask
Changsheng Chen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Human retinal microvascular endothelial cells (HRMECs, Cell System) were cultured in a complete classic medium supplemented with/without high-content glucose (50 or 100 mM) ...
-
No products found
because this supplier's products are not listed.
Hongbo Zhang, et al.,
bioRxiv - Microbiology 2019
Quote:
... human fibroblasts were seeded in µ-Slides (Ibidi GmbH, Martinsried, Germany) containing carbon-coated sapphire discs (Engineering Office M ...
-
No products found
because this supplier's products are not listed.
Théo Juncker, et al.,
bioRxiv - Immunology 2023
Quote:
The coding sequence of the Dnmt1-chromobody targeting the human Dnmt1 protein [37] (Uniprot : P26358 · DNMT1_HUMAN) and lamin-chromobody (ChromoTek) targeting the lamin D0 from Drosophila monogaster (Uniprot ...