-
No products found
because this supplier's products are not listed.
Steven G. Sayson, et al.,
bioRxiv - Immunology 2024
Quote:
... anti-Citrullinated Histone H3 (1:100; Abbomax, San Jose, California), or anti-Myeloperoxidase (1:100 ...
-
Histone-lysine N-methyltransferase EZH2 (165-174) is a bioactive peptide of Histone-lysine...
Cat# BAT-009911,
Inquire
Ask
Minjoo Kim, et al.,
bioRxiv - Biochemistry 2019
Quote:
... The resulting whole cell lysate was then tumbled with N,N-dimethyl-N-dodecylglycine (Empigen BB Detergent, BOC Sciences) (3% v/v ...
-
No products found
because this supplier's products are not listed.
Pascale Lemieux, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... and lysine) containing 200 μg/ml methotrexate (MTX, Bioshop Canada) diluted in dimethyl sulfoxide (DMSO ...
-
No products found
because this supplier's products are not listed.
Ricardo Iván Martínez-Zamudio, et al.,
bioRxiv - Genomics 2019
Quote:
... Histone modification libraries were constructed using the NextFlex ChIP-seq kit (Bioo Scientific) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Hannah J. Larsen, et al.,
bioRxiv - Physiology 2022
Quote:
... Arachidonic Acid (P/N 390) and ADP (P/N 384) were purchased from Chrono-Log Corporation ...
-
No products found
because this supplier's products are not listed.
Pierre-Louis Hollier, et al.,
bioRxiv - Physiology 2020
Quote:
... or rec N-Shh (Shenandoah biotechnology) diluted in 10 μL sterile phosphate-buffered saline (PBS ...
-
No products found
because this supplier's products are not listed.
Ugo Tomasello, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... three sections for each brain electroporated at E14.5 with pUB6-TOM and pSilencer-U6-scram (number of brains, n = 4) or pSilencer-U6-miR-137 (number of brains, n = 4) and injected with retrobeads (Lumafluor) at P9 ...
-
No products found
because this supplier's products are not listed.
Natalie C. Butterfield, et al.,
bioRxiv - Genetics 2019
Quote:
... harboring alanine/alanine or threonine/threonine polymorphisms for the deiodinase 2 gene at codon 92 (Dio2Ala92, n=9 and Dio2Thr92, n=10) were generated by Applied Stemcell Inc ...
-
No products found
because this supplier's products are not listed.
Whasil Lee, et al.,
bioRxiv - Molecular Biology 2020
Quote:
Paraffin-embedded tissue sections (15 µm) of human articular cartilage from healthy (n=5) and OA-positive (n=6) anonymized donors were used (Articular Engineering, IL). Sections were immunolabeled with Piezo1-antibody (NBP1-78537 ...
-
No products found
because this supplier's products are not listed.
Samuel T. Bailey, et al.,
bioRxiv - Physiology 2022
Quote:
... Samples were collected and homogenized in large groups (N=60 males and N=20 females) and homogenized using a BeadBlaster 24 microtube homogenizer (Benchmark Scientific, Edison, NJ, USA). Soluble protein was measured using the Bradford method (BioRad ...
-
No products found
because this supplier's products are not listed.
Geoffrey M.W. Cook, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... was acetylated with acetic acid N-hydroxysuccinimide ester (Apollo Scientific) as described64 and the product shown to be homogeneous by thin layer chromatography ...
-
No products found
because this supplier's products are not listed.
Kathryn V. Svec, Mingu Kang, Alan K. Howe,
bioRxiv - Cell Biology 2023
Quote:
... Acrylamide and N,NI-methylenebisacrylamide were purchased from National Diagnostics. Tetramethylethylenediamine (TEMED) ...
-
No products found
because this supplier's products are not listed.
Adele Stewart, et al.,
bioRxiv - Neuroscience 2022
Quote:
... brains from WT (n=4) and DAT Val559 (n=4) male mice were harvested and stained using the FD Rapid GolgiStain kit (FD Neurotechnologies, cat # PK401, Columbia, MD, USA) per the manufacturer’s instructions[41 ...
-
No products found
because this supplier's products are not listed.
Samuel Lim, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... turbonuclease (Accelagen) and 1% n-Nonyl-Beta-D-Glucopyranoside (Cube Biotech) and shaken vigorously for 1 hour ...
-
No products found
because this supplier's products are not listed.
Jan A. Veenstra,
bioRxiv - Zoology 2023
Quote:
... Peptides with an N- or C-terminal cysteine were conjugated through this residue using 4-(N-Maleimidomethyl)cyclohexane-1-carboxylic acid 3-sulfo-N-hydroxysuccinimide ester (AK Scientific, Inc., Union City, CA 94587, USA) to bovine serum albumin (BSA) ...
-
No products found
because this supplier's products are not listed.
Kelly A. Curtis, et al.,
bioRxiv - Microbiology 2020
Quote:
... Five HIV-1 seroconversion panels (n=42 specimens) were purchased from Zeptometrix Corp ...
-
No products found
because this supplier's products are not listed.
Liam Hudson, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Crude material was usually adsorbed on diatomaceous earth (Biotage Isolute HM-N) and subjected to chromatography (dry-loading) ...
-
No products found
because this supplier's products are not listed.
Élora Midavaine, et al.,
bioRxiv - Neuroscience 2023
Quote:
... coupling reagents (ChemImpex International) and N-methylpyrrolidinone (A&C American Chemicals Ltd) were HPLC grade ...
-
No products found
because this supplier's products are not listed.
David Veysset, et al.,
bioRxiv - Bioengineering 2021
Quote:
... on top of a 1-inch borosilicate glass substrate (n°2 coverslip, ChemGlass) (Layer 5) ...
-
No products found
because this supplier's products are not listed.
Michael S. Haney, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The dissociated neurons were then plated onto 24-well plates with coverslips coated with poly-l-lysine (Newcomer Supply, 1339A) using minimum essential medium (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Kathleen M. Mulvaney, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... the N-terminal tag was removed by incubation with HRV 3C protease (AG Scientific) and further purified by Superose 6 column ...
-
No products found
because this supplier's products are not listed.
Samim Ali Mondal, et al.,
bioRxiv - Physiology 2022
Quote:
... (4) CCl4 + 17α preventive (n=18): chow+17α (14.4 mg/kg; Steraloids, Newport, RI)-fed for eight weeks while simultaneously being CCl4-treated twice weekly for eight weeks ...
-
No products found
because this supplier's products are not listed.
Sanchita Bhadra, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... SARS-CoV-2 N gene armored RNA was obtained from Asuragen (Austin, TX, USA). SARS-CoV-2 viral genomic RNA was obtained from American Type Culture Collection (Manassas ...
-
No products found
because this supplier's products are not listed.
Nicolas Gutierrez-Castellanos, et al.,
bioRxiv - Neuroscience 2023
Quote:
... N=4) at 27.6 nL/min using a nanoliter injector (Nanoject II, Drummond Scientific) at 0.1 Hz ...
-
No products found
because this supplier's products are not listed.
Jonathan L. Schmid-Burgk, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... using primers and probes against the N-gene (N_Sarbeco_F: CACATTGGCACCCGCAATC, N_Sarbeco_R: GAGGAACGAGAAGAGGCTTG, N_Sarbeco_P: FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ, TIB MolBiol). Spike-in RNA of the bacteriophage MS2 served as an interal control and was detected with Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs ...
-
No products found
because this supplier's products are not listed.
Yue Hu, et al.,
bioRxiv - Neuroscience 2024
Quote:
... ISO group (n=6) mice were handled and inhaled 1.5% isoflurane (RWD Life Science, 1903715) at 13:00 on day four in the chamber ...
-
No products found
because this supplier's products are not listed.
FuiBoon Kai, et al.,
bioRxiv - Cell Biology 2021
Quote:
MCF10A MECs stably expressing farnesylated APEX2 (APEX2-CAAX) were cultured in lysine- and arginine-free DMEM/F12 media supplemented with dialyzed horse serum (Gemini Bio-Products), EGF ...
-
No products found
because this supplier's products are not listed.
Michel Engeln, et al.,
bioRxiv - Neuroscience 2019
Quote:
... mice were injected with 0.5mg/kg clozapine-N-oxide (i.p.; LKT Laboratories, St. Paul, MN, USA) 30 min prior to behavioral testing.
-
No products found
because this supplier's products are not listed.
Andrey Zakharchenko, et al.,
bioRxiv - Biochemistry 2022
Quote:
Glutaraldehyde-fixed BP samples (n=5) were punched using 8 mm biopsy punches (Medline, Northfield, IL). Samples were rinsed with PBS and then incubated for 28 days in PBS with the following conditions either without inhibitors (Control ...
-
No products found
because this supplier's products are not listed.
Yang Sylvia Liu, et al.,
bioRxiv - Biochemistry 2023
Quote:
... aeruginosa lysine auxotrophic strain ΔlysA was grown in the liquid ABTG medium with Amino acid Drop-out Mix Minus Lysine without Yeast Nitrogen Base powder (United States Biological, MA) and 500 μM 13C-L-lysine (L-lysine:2HCl ...
-
No products found
because this supplier's products are not listed.
Julia Hansen, et al.,
bioRxiv - Microbiology 2022
Quote:
... ethyl-[R]-cysteinyl-[S]-lysyl-[S]-lysyl-[S]-lysyl-[S]-lysyl-[S]-lysine(ε-aminocaproyl-∈-aminocaproyl-biotinyl) x 3 CF3COOH (EMC Microcollections, Tübingen, Germany) at 1.5 mg/ml in carbonate buffer (pH 9.2 ...
-
No products found
because this supplier's products are not listed.
Burt M Sharp, Qin Jiang, Panjun Kim, Hao Chen,
bioRxiv - Neuroscience 2023
Quote:
... 2-(3-(4-chloro-3-fluorophenyl)-5-ethyl-1H-1,2,4-triazol-1-yl)-N-(3,5-di-chlorobenzyl)acetamide (MR-L2) was from Targetmol Chemicals ...
-
No products found
because this supplier's products are not listed.
Jennifer Hsiao-Nakamoto, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Corresponding brain sections from age and sex matched non-carrier controls (n=15) were purchased from BioIVT. A demographic summary is provided in Table 2.
-
No products found
because this supplier's products are not listed.
Bojana Kokinovic, et al.,
bioRxiv - Neuroscience 2024
Quote:
... equipped with LUMPlanFL N 40x/0.8w water immersion objective and Prime BSI Express sCMOS camera (Teledyne Photometrics). CoolLED pE-300 was used as a source of green/blue light ...
-
No products found
because this supplier's products are not listed.
Chen Liu, et al.,
bioRxiv - Cell Biology 2023
Quote:
... was labeled with 5′-801 carboxytetramethylrhodamine at the N-terminus (TAMRA-PEP1) with an HPLC purity of 95.24% and molecular weight of 2905.24 (EZBiolab). The peptide was dissolved in water to obtain 1 mM peptide stocks ...
-
No products found
because this supplier's products are not listed.
Shan Zhao, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 200 mM SDS and 25% w/v N-Methyldiethanolamine) at 37 °C on a shaking rocker (IKA, 2D digital). The solutions were refreshed when the color changed to green until colorless ...
-
No products found
because this supplier's products are not listed.
Vignesh Jayarajan, et al.,
bioRxiv - Cell Biology 2022
Quote:
The ROCKi inhibitor Y-27632 ((R)-(+)-trans-4-(1-aminoethyl)-N-(4-pyridyl) cyclohexanecarboxamide-2) was purchased from AdooQ Bioscience (#A1101 ...
-
No products found
because this supplier's products are not listed.
Galina A. Gusarova, et al.,
bioRxiv - Physiology 2021
Quote:
... we synthesized nitrilotriacetic acid (NTA) to the N-terminus of TAT (amino acids 48-60, CHI Scientific, Maynard, Mass.). Then ...
-
No products found
because this supplier's products are not listed.
Dewi Safitri, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... HEK293T cells overexpressing full-length GIPR or GLP-1R with an N-terminal FLAG tag were purchased from Multispan, Inc (Hayward ...
-
No products found
because this supplier's products are not listed.
Bijoya Sen, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Blood was collected from healthy donors (N=5) and PBMCs were isolated using Lymphoprep™ (Alere Technologies AS, Oslo, Norway) according to manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Gabriella T. Heller, et al.,
bioRxiv - Biophysics 2020
Quote:
... recombinant Aβ42 peptide (the 42-residue variant lacking the N-terminal M, see ‘Preparation of recombinant Aβ peptides’) was purchased from rPeptide and prepared following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Ethan S. Bromberg-Martin, et al.,
bioRxiv - Neuroscience 2022
Quote:
... A subset of Pal neurons (n=30) were recorded using single-contact glass-coated electrodes (Alpha Omega) or epoxy-coated electrodes (FHC) from which spikes were sorted offline (Plexon Offline Sorter) ...
-
Yuxin Duan, et al.,
bioRxiv - Biophysics 2022
Quote:
... (Waltham, MA) N-hydroxyl succinimide-5 kDa PEG-biotin (NHS-PEG-biotin, HE041024-5K) was purchased from Biochempeg (Watertown, MA). 3-Aminopropyl triethoxysilane (APTES ...
-
No products found
because this supplier's products are not listed.
Koichi Sato, Aiko G.M. Hendrikx, Puck Knipscheer,
bioRxiv - Biochemistry 2023
Quote:
... The wild-type protein was overexpressed as a N-terminal His6-tagged protein in the E.coli JM109(DE3) cells (Intact Genomics) cultured in 4.4 L LB medium and purified by the previously described method53 ...
-
No products found
because this supplier's products are not listed.
Yu Han, et al.,
bioRxiv - Biochemistry 2024
Quote:
... Fetal heart and postnatal hearts (n=5 each) were acquired commercially at E17.5 and P1 from Zyagen (San Diego, CA), weighed ...
-
No products found
because this supplier's products are not listed.
Transito Garcia-Garcia, et al.,
bioRxiv - Microbiology 2020
Quote:
... Antibodies against the HA and SNAP epitope were purchased from Osenses and New England BioLabs ...
-
No products found
because this supplier's products are not listed.
Airi Tarutani, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Secondary antibodies were conjugated to 5 nm gold particles (Cytodiagnostics, 1:50). Immunostained grids were negatively stained with 2% phosphotungstic acid and dried ...
-
No products found
because this supplier's products are not listed.
Maria Zhivagui, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Immunofluorescence staining was carried out using anti-cyclobutane pyrimidine dimers (CPDs) monoclonal antibodies (clone KTM53, Kamiya Biomedical) and anti-6-4 photoproducts monoclonal antibodies (Clone 64M-2 ...
-
No products found
because this supplier's products are not listed.
Daiana Martire-Greco, et al.,
bioRxiv - Immunology 2021
Quote:
... conditioned media (CM) were collected and incubated for 2 h with an anti-Stx antibody (anti-Stx2 variant from Toxin Technology, USA) to block the direct effect of Stx ...
-
No products found
because this supplier's products are not listed.
Xiaopeng Tang, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... FXa-AT-III complex was detected by incubation with HRP-conjugated anti-human AT-III antibody (1: 200, SAAT-APHRP, Enzyme Research Laboratory, USA). Relative level of TAT and FXa-AT-III complex was calculated.