-
No products found
because this supplier's products are not listed.
Ariane Bruder-Nascimento, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Male mice were infused with vehicle or Ang-II (490 ng/min/kg) for 14 days with ALZET osmotic minipumps (Alzet Model 1002; Alzet Corp Durect, Cupertino, CA) while receiving regular drinking water.
-
No products found
because this supplier's products are not listed.
Liza R. Moscovice, et al.,
bioRxiv - Animal Behavior and Cognition 2023
Quote:
... Samples were collected voluntarily from pigs using SalivaBio® Infant Swabs (Salimetrics, CA, USA). Cortisol analyses were conducted at the FBN ...
-
No products found
because this supplier's products are not listed.
Lucy A. Barry, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Fluorescent lysosomal storage was imaged using a GFP Brightline 490 nm excitation/510 nm emission filter set (GFP-3035C; Semrock Inc, IDEX Corporation, IL, USA). Thresholding analysis was performed on ImageJ to determine the percentage of fluorescence per sampled area.
-
No products found
because this supplier's products are not listed.
Valeria Fumagalli, et al.,
bioRxiv - Immunology 2021
Quote:
... and monitored by recording changes in light transmittance through the PRP suspension using a Chrono-log model 490 aggregometer (Chrono-log Corporation, Havertown, PA).
-
No products found
because this supplier's products are not listed.
Xiyuan Bai, et al.,
bioRxiv - Immunology 2022
Quote:
... Anti-CTLA-4 neutralizing antibody and non-immune human IgG antibody were purchased from BPS Bioscience Inc (San Diego ...
-
No products found
because this supplier's products are not listed.
Jayne E. Wiarda, et al.,
bioRxiv - Immunology 2022
Quote:
... mouse α-pig γδTCR-iFluor594 (primary antibody Washington State University PG2032; custom conjugation to iFluor594 performed by Caprico Biotechnologies); mouse α-pig CD4-PerCP-Cy5.5 (BD 561474) ...
-
No products found
because this supplier's products are not listed.
Seokho Kim, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Insulin from supernatants and the NICC lysates was quantified using the pig insulin ELISA kit (Mercodia, 10-12000-01). Secreted insulin is presented as a percent of total insulin detected in lysate ...
-
No products found
because this supplier's products are not listed.
Elizabeth V. K. Ledger, Andrew M. Edwards,
bioRxiv - Microbiology 2023
Quote:
... or C3 was detected with a 1:1000 dilution of goat anti-human C3 F(ab’)2 labelled with FITC (Protos Immunoresearch). Antibody incubations were carried out statically for 1 h at room temperature in the dark ...
-
No products found
Meng Wu, et al.,
bioRxiv - Immunology 2023
Quote:
... The C3-expressing cells isolated from C3IRES-tdTomato C57BL/6 and WT mice were cultured and stained with goat anti-tdTomato in a 96-well plate with glass-like polymer bottom (Cellvis P96-1.5P) and imaged using a widefield microscopy to test anti-tdTomato antibody (Figure S4A-C).
-
No products found
because this supplier's products are not listed.
David J. Speicher, et al.,
bioRxiv - Microbiology 2020
Quote:
... and RIDASCREEN® Mumps IgG (K5521) from R-Biopharm AG (Darmstadt ...
-
No products found
because this supplier's products are not listed.
Ankita Datey, et al.,
bioRxiv - Microbiology 2019
Quote:
The serum samples were also subjected to indirect ELISA to detect the presence of IgG antibodies against JEV using Porcine JE IgG ELISA Kit (Glory Science Co., Ltd, USA) in accordance with the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Kevin R. McCarthy, et al.,
bioRxiv - Microbiology 2020
Quote:
... Bulk IgGs were captured by protein A agarose resin (GoldBio) at 4°C rotating overnight ...
-
No products found
because this supplier's products are not listed.
Breanna Q. Shen, et al.,
bioRxiv - Neuroscience 2022
Quote:
Slides were incubated with blocking buffer (10% Normal Goat Serum, Atlanta Biologicals, Cat #S13150h ...
-
Recombinant Pig BCMA Protein(XP_020943721.1), fused to His tag, was expressed in HEK293.
Cat# TNFRSF17-03P,
10ug , USD $198
Ask
Sunil Yeruva, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Recombinant protein of human DSG2 tagged with IgG Fc domain (Fc) (Creative Biomart; #DSG2-1601H) and N-CAD-Fc (Sino Biological ...
-
No products found
because this supplier's products are not listed.
Victor Yin, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Samples are then diluted with the Sciex IgG Purity/Heterogeneity kit sample buffer (Sciex, MA, USA) and beta-mercaptoethanol (BME ...
-
No products found
because this supplier's products are not listed.
Hiroyuki Yamamoto, Tetsuro Matano,
bioRxiv - Immunology 2023
Quote:
... SIV virion-specific IgGs in plasma were detected with a SIVmac239-cross-reactive western blotting system (ZeptoMetrix). In the NAb non-inducers ...
-
No products found
because this supplier's products are not listed.
Volha Liaudanskaya, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and Anti-Anti (1%) from Sciencell research laboratories (cat.no ...
-
No products found
because this supplier's products are not listed.
Kimmo Rantalainen, et al.,
bioRxiv - Immunology 2019
Quote:
... for IgG was mixed with 25 mL Opti-MEM containing 2,250 µg polyethylene imine MAX (MW 40,000; Polyscience - 24765-1). After incubation for 20 min at RT ...
-
No products found
because this supplier's products are not listed.
Giovannino Silvestri, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... anti-SET (Globozymes); anti-ABL (Ab-3) ...
-
No products found
because this supplier's products are not listed.
Qinghong Xue, et al.,
bioRxiv - Immunology 2019
Quote:
... and goat IgG (i.e., three positive control points) were printed in 4×4 array by non-contact spotter sciFLEXARRAYER S1 (Scienion, Berlin, Germany) (Fig 2d) ...
-
No products found
because this supplier's products are not listed.
Ali Zhang, et al.,
bioRxiv - Immunology 2021
Quote:
... the media was replaced with 50 μl of assay buffer (RPMI 1640 supplemented with 4% (vol/vol) low IgG FBS) containing oseltamivir carboxylate (Toronto Research Chemicals) and serial dilutions of monoclonal antibodies or serum ...
-
No products found
because this supplier's products are not listed.
Soo Jeong Kim, et al.,
bioRxiv - Neuroscience 2022
Quote:
... or Flamma 648 conjugated goat anti-rabbit IgG (Cat# A-11008, RRID: AB_143165 and Cat# A-11011, RRID: AB_143157, Molecular Probes and Cat# RSA1261, BioActs, Incheon, South Korea) and Alexa Fluor 488 or 568 conjugated goat anti-mouse antibodies (Cat# A-11004 ...
-
No products found
because this supplier's products are not listed.
Emma J Agnew, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Slides were blocked with 5% goat serum and Collagen Hybridizing Peptide (CHP) solution (15μM, BIO300, 3Helix, Salt Lake City, UT) prepared by heating to 80°C before placing in ice for 15 seconds prior to addition to tissue sections for overnight incubation at 4°C ...
-
No products found
because this supplier's products are not listed.
Zhuqing Zheng, et al.,
bioRxiv - Genomics 2020
Quote:
... total RNA was isolated from the abomasum pyloric with high expression of MUC6 from two heterozygous goats and sequenced by PacBio Sequel ...
-
No products found
because this supplier's products are not listed.
Amanda J. McLaughlin, et al.,
bioRxiv - Neuroscience 2020
Quote:
... sheep anti-secretagogin (BioVendor, RD1884120100 ...
-
No products found
because this supplier's products are not listed.
Laura Rolland, et al.,
bioRxiv - Cell Biology 2023
Quote:
anti-Trpc6 (OST00081W, Osenses)
-
No products found
because this supplier's products are not listed.
Sanne van der Niet, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Dihydrochloride) detection was performed using anti dinitrophenol (DNP) (Polyclonal Anti-DNP, Oxford Biomedical Research). All antibodies were diluted in 1% BSA in PBS ...
-
No products found
because this supplier's products are not listed.
Michal Schwartz, et al.,
bioRxiv - Microbiology 2022
Quote:
... mouse anti-PP28 (EastCoast Bio), rabbit anti-GAPDH (Cell Signaling Technology) ...
-
No products found
because this supplier's products are not listed.
Guang Lin, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rabbit anti-GlcCer (Glycobiotech; RAS_0010); Mouse anti-ATP5a (Abcam ...
-
No products found
because this supplier's products are not listed.
Katrina Mekhail, et al.,
bioRxiv - Cell Biology 2022
Quote:
... anti-C9 agarose bead (Cube Biotech), HA antibody (Abcam ...
-
No products found
because this supplier's products are not listed.
Ying Xu, et al.,
bioRxiv - Bioengineering 2023
Quote:
Anti-fibrotic drugs Pirfenidone (P1871, TCI America) and KD025 (HY-15307 ...
-
No products found
because this supplier's products are not listed.
Thomas Germe, et al.,
bioRxiv - Biochemistry 2023
Quote:
... for 10 min before incubating at 4°C overnight with monoclonal antibody (either anti-GyrA-CTD – 4D3 or anti-GyrB-CTD – 9G8; a gift from Alison Howells, Inspiralis) diluted 1/1000 in TBS-T 5% milk ...
-
No products found
because this supplier's products are not listed.
Rebecca Kochanowsky, et al.,
bioRxiv - Microbiology 2022
Quote:
... Anti-Myc antibody (Protein Mods, Madison WI, USA) was used at 1:5,000 and the detecting anti-mouse antibody (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Anu G. Nair, Paola Muttathukunnel, Martin Müller,
bioRxiv - Neuroscience 2021
Quote:
... and Atto594 conjugated anti-mouse (ATTO-TEC; 1:100). Images were acquired using an upright Leica Stellaris or inverted Leica SP8 laser scanning microscope (University of Zurich Center for Microscopy and Image Analysis ...
-
No products found
because this supplier's products are not listed.
Robyn M. Barfield, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... The murine anti-maytansine antibody was made by ProMab and validated in-house ...
-
No products found
because this supplier's products are not listed.
Rachana R. Chandran, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... rabbit anti-SMMHC (1:100, Thermo Scientific-Alfa Aesar), rabbit anti- Ki67 (1:100 ...
-
No products found
because this supplier's products are not listed.
Mayank Verma, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... 1 µg/ml anti-FLT1 monoclonal antibody (Angio-Proteomie, MAB7072), inhibitors of FLK1 ...
-
No products found
because this supplier's products are not listed.
Piyakarn Boontem, Tetsumori Yamashima,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... rabbit anti-human activated μ-calpain antibody (PEPTIDE Institute, Japan) at 1:250 overnight ...
-
No products found
because this supplier's products are not listed.
Sameer Ahmed Bhat, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-phospho-cofilin-S3 (St Johns Laboratory, STJ90230; 1:2000 IB); anti-cofilin (CST ...
-
No products found
because this supplier's products are not listed.
Fabienne Podieh, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... anti-ubiquitin (FK2; #A-106, Boston Biochem and #BML-PW8810, Enzo Life Sciences), anti-ICAM1 (#sc-8439 ...
-
No products found
because this supplier's products are not listed.
Amrita Das Gupta, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Anti-IBA1 (polyclonal rabbit) antibody (Fujifilm – Cellular dynamics; #019-19741; dilution 1:250), Anti-S100ß (polyclonal chicken ...
-
No products found
because this supplier's products are not listed.
Irmgard U. Haussmann, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... a T7 promoter oligonucleotide (CCTGGCTAATACGACTCACTATAG) was annealed to an anti-sense Ultramer (IDT DNA) encoding the entire sgRNA in addition to the T7 promoter ...
-
No products found
because this supplier's products are not listed.
Christine Vazquez, Chin Yee Tan, Stacy M. Horner,
bioRxiv - Microbiology 2019
Quote:
... and immunostained with the following antibodies: mouse anti-HCV NS4A (Genotype 1B, 1:100, Virogen), rabbit anti-HA (1:100 ...
-
No products found
because this supplier's products are not listed.
Susan E. Maloney, et al.,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
... each animal was given 0.25 mg of the chewable anti-inflammatory Rimadyl (Bio-Serv, Flemington, NJ) and the surgical area was shaved ...
-
No products found
because this supplier's products are not listed.
Frederike Klimm, Thomas Speck, Marc Thielen,
bioRxiv - Plant Biology 2023
Quote:
... by using the primary antibody LM6 ([Anti-1,5-α-L-Arabinan] Antibody, Megazyme Ltd, Bray, Ireland) and a fluorescent marker (Alexa Fluor 568 goat anti-rat IgG (H+L) ...
-
No products found
because this supplier's products are not listed.
Maria Zhivagui, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Immunofluorescence staining was carried out using anti-cyclobutane pyrimidine dimers (CPDs) monoclonal antibodies (clone KTM53, Kamiya Biomedical) and anti-6-4 photoproducts monoclonal antibodies (Clone 64M-2 ...
-
No products found
because this supplier's products are not listed.
Ben Nicholas, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 2 mg of anti-MHC-I mouse monoclonal antibodies (W6/32) covalently conjugated to Protein A sepharose (Repligen) using DMP as previously described [42,43] were added to the clarified supernatants and incubated with constant agitation for 2 h at 4°C ...
-
No products found
because this supplier's products are not listed.
Jacqueline M. Tokarew, et al.,
bioRxiv - Neuroscience 2020
Quote:
... A 0.4 % horseradish peroxidase solution was prepared using HRP-linked anti-rabbit secondary antibody diluted in Stabilizyme solution (SurModics SZ02). Each read was set up in triplicate on a white polystyrene 96-well plate (ThermoFisher 236105 ...
-
Goat polyclonal antibody specific for Human IgG, purified by affinity chromatography
Cat# PAB21443-1000,
1.0mg USD $168.95
Ask
Jiarui Wang, et al.,
bioRxiv - Cell Biology 2022
Quote:
... wild type cells were incubated with 100 μL Hybridization Buffer containing 2 μL 12.5 μM CF568-labled gRNA FISH probes and 1:500 anti-Spike antibodies (Cat# PAB21477-500, The Native Antigen Company) for 4 hours in the dark ...
-
No products found
because this supplier's products are not listed.
Xiaopeng Tang, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... FXa-AT-III complex was detected by incubation with HRP-conjugated anti-human AT-III antibody (1: 200, SAAT-APHRP, Enzyme Research Laboratory, USA). Relative level of TAT and FXa-AT-III complex was calculated.