-
No products found
because this supplier's products are not listed.
Michael G. Spelios, et al.,
bioRxiv - Immunology 2021
Quote:
... purified His-tagged ACE2 (EpiGentek) was added at a concentration of 100 ng/well (prepared with PBS ...
-
No products found
because this supplier's products are not listed.
Xian Zhou, et al.,
bioRxiv - Immunology 2020
Quote:
... Human B cell proliferation was measured by 3[H]-thymidine incorporation (1 μCi/mL) (American Radiolabeled Chemicals).
-
No products found
because this supplier's products are not listed.
Michael P. Doyle, et al.,
bioRxiv - Immunology 2022
Quote:
... his-tagged YFV E protein (Meridian Life Science) was associated to the tips at 5 μg/mL for 60 sec ...
-
No products found
because this supplier's products are not listed.
Dennis J Doorduijn, et al.,
bioRxiv - Immunology 2019
Quote:
... Nunc Maxisorp ELISA plates were coated overnight at 4 °C with 50 µl/well of 3 µg/ml monoclonal mouse IgG1 anti human C6 (Quidel) in PBS ...
-
WB, ELISA
Cat# CDC-41,
0.1 mg, Inquire
Ask
Ilaria Frasson, et al.,
bioRxiv - Microbiology 2023
Quote:
... We conducted genome-wide negative selection (dropout) screens in Cas9-Calu-3 cells by using the human GeCKO v2 library (Creative Biogene, cat. CCLV0001) that targets 18823 genes with 6 gRNAs/gene as well as 1000 non-targeting gRNAs ...
-
No products found
because this supplier's products are not listed.
Lanpeng Chen, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... anti-human Nanog and anti-human Oct-4 were obtained from Cell Science Signaling ...
-
No products found
because this supplier's products are not listed.
Maria E. Candela, et al.,
bioRxiv - Immunology 2021
Quote:
Treatments with HBD3 peptide(s) was after 15-30 minutes 5 μg/ml of human β-Defensin-3 (hBD3) (Peptide Institute Inc., PeptaNova GmbH #4382-s), or 5 μg/ml of Linear Defensin (Almac Sciences Scotland Ltd ...
-
No products found
because this supplier's products are not listed.
Alexa Schuettenberg, et al.,
bioRxiv - Immunology 2022
Quote:
... normal human IgG (ProSci #5503) on each plate as a positive control ...
-
No products found
because this supplier's products are not listed.
Manuel Göpferich, et al.,
bioRxiv - Neuroscience 2020
Quote:
... human FGF (20 ng/μl, ReliaTech) and human EGF (Promokine) ...
-
No products found
because this supplier's products are not listed.
Sherine E. Thomas, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Wizard 3&4 (Molecular Dimensions), JCSG +Suite (Molecular Dimensions) ...
-
No products found
because this supplier's products are not listed.
Tobias Tertel, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 12 nM anti-human CD63 PE (EXBIO) or 13 nM anti-human CD81 PE (Beckman Coulter) ...
-
No products found
because this supplier's products are not listed.
Nazila V. Jafari, Jennifer L. Rohn,
bioRxiv - Microbiology 2022
Quote:
HBLAK human bladder progenitor cells (CELLnTEC, Switzerland) were grown according to the CELLnTEC protocol ...
-
No products found
because this supplier's products are not listed.
V. Praveen Chakravarthi, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... 30 IU of human chorionic gonadotropin (hCG; BioVendor) was injected intraperitoneally ...
-
Recombinant Glypican 3 (GPC3) is a recombinant Human protein produced in E. coli using...
Cat# abx066892-1MG,
1 mg USD $2276.5
Ask
José-María Díez, Carolina Romero, Rodrigo Gajardo,
bioRxiv - Immunology 2020
Quote:
The following kits were used for the qualitative determination of IgG class antibodies against human coronaviruses: abx052609 Human Coronavirus IgG ELISA kit (Abbexa, Cambridge, UK), against an undetermined antigen ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Membranes were blocked in skim milk and incubated with anti-MASP-3 mAb 38:12-3 (Hycult Biotech, HM2216) for 1.5h at RT and HRP-conjugated rabbit anti-rat (Agilent ...
-
No products found
because this supplier's products are not listed.
Asha A. Philip, John T. Patton,
bioRxiv - Microbiology 2022
Quote:
... A puc19 plasmid containing a RIX/NSP3-2A-P-His insert under the control of a T7 transcription promoter (puc19/T7/ RIX/NSP3-2A-P-His) was purchased from Bio Basic Canada Inc ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Diana R. Dou, et al.,
bioRxiv - Immunology 2021
Quote:
... and mouse anti-human CD4 (Tonbo Biosciences, 20-0048-T025), and sorted for live 7-AAD- CD3+ CD4+ T-lymphocytes using the BDFACS ARIA II with a 100 uM nozzle ...
-
No products found
because this supplier's products are not listed.
Linlin You, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... coli TTC-pause at 13 mg/mL was incubated with 3-([3-cholamidopropyl] dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, 8 mM, final concentration; Hampton Research Inc.) prior to grid preparation ...
-
No products found
because this supplier's products are not listed.
Pavan Nayak, Arul Subramanian, Thomas Schilling,
bioRxiv - Developmental Biology 2022
Quote:
... using a BeadBug 3 Microtube Homogenizer D1030 (Benchmark Scientific), and RNA was extracted using Trizol according to the standard protocol (Invitrogen 15596018) ...
-
No products found
because this supplier's products are not listed.
Carlos A. Sánchez-León, et al.,
bioRxiv - Neuroscience 2020
Quote:
... a polyethylene tubing (3 mm inner diameter; A-M Systems), which acted as the active electrode for tRNS ...
-
No products found
because this supplier's products are not listed.
Matthias Schmidt, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and 3-hydroxy-2,4-dimethylhexanoic acid were synthesized by Enamine (Ukraine).
-
No products found
because this supplier's products are not listed.
MR Melo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rats were transferred to a stereotaxic frame (incisor bar +3 mm; RWD Life Science). To perform the optogenetic experiments ...
-
No products found
because this supplier's products are not listed.
Justine Creff, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 200 µg for HEK293) were incubated with 3 µg of the indicated antibodies and 12 µL protein sepharose beads (IPA300, Repligen) at 4°C for 4 h ...
-
No products found
because this supplier's products are not listed.
Bjoern Traenkle, et al.,
bioRxiv - Immunology 2021
Quote:
... an alpaca (Vicugna pacos) was immunized with the purified extracellular domains of human CD4 (aa26-390) recombinantly produced in HEK293 cells (antibodies-online GmbH, Germany). After initial priming with 1 mg ...
-
No products found
because this supplier's products are not listed.
Yanrui Yang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... mouse anti-His (CoWin Biosciences, Jiangsu, China), rabbit anti-calmodulin (Boster Biological Technology ...
-
No products found
because this supplier's products are not listed.
Anil Verma, et al.,
bioRxiv - Immunology 2023
Quote:
... were labeled with biotinylated anti-His tag monoclonal antibody (ThermoScientific) and used to capture His-tagged clade C gp120 Du151 protein (Immune Technologies). The gp120-expressing beads were then incubated with triplicate 5-fold dilutions of heat-inactivated serum samples in V-bottom plates for 1h at 37°C ...
-
No products found
because this supplier's products are not listed.
Saejeong Park, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... HEK293 cells were washed with PBS and lysed in NP-40 lysis buffer (Boston Bioproducts) including protease and phosphatase inhibitor (Roche) ...
-
WB, IF,ELISA
Cat# A5199, SKU# A5199-20ul,
20ul, $47.00
Ask
Xuxiao He, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... and Nickel Magnetic Beads for His tag protein purification (Bimake, B23602) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Shanshan Lang, et al.,
bioRxiv - Bioengineering 2019
Quote:
... The recombinant extracellular domain of CD38 and PD-L1 was produced as a 6-His and AviTag™ fusion in HEK293 cells and purified by Ni-NTA followed by in vitro biotinylation by BirA biotin ligase (Avidity).
-
No products found
because this supplier's products are not listed.
Ahmed Seddek, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Purified recombinant human TOP1 (TopoGEN) was used as positive control.
-
No products found
because this supplier's products are not listed.
Naomi R. Shvedov, et al.,
bioRxiv - Neuroscience 2023
Quote:
... a 3 mm diameter round coverglass (3 mm circular, #1, Thomas Scientific), bonded to a stainless steel cannula (304 S/S Tubing .125” OD x .115” ID x 0.019” ...
-
No products found
because this supplier's products are not listed.
Nicholas G. Lamson, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 1-Ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) was purchased from Chem-Impex. Falcon cell strainer tubes were purchased from Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Qi Qu, et al.,
bioRxiv - Physiology 2023
Quote:
... TAG(16:0)3-d5 and TAG(18:0)3-d5 (CDN isotopes), while DAGs d5-DAG17:0/17:0 and d5-DAG18:1/18:1 (Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Daniel A. Kramer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... All measurements were performed on a Horiba Scientific FluoroMax spectrofluorometer in 3 mm quartz cuvettes (Starna Cells, Inc. Cat # 3-3.45-Q-3). Normalized peak fluorescent values were calculated by dividing the fluorescence value of the peak by the concentration of that sample.
-
No products found
because this supplier's products are not listed.
Thi K. Tran-Nguyen,
bioRxiv - Molecular Biology 2021
Quote:
Recombinant human GRP78s purchased from StressMarq Biosciences or produced in the laboratory [30] were used as antigens in ELISA ...
-
No products found
because this supplier's products are not listed.
Mingqi Zhou, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 3 U APEX Taq (Genesee Scientific), and molecular-grade H2O to bring the total volume to 35 μl.
-
No products found
because this supplier's products are not listed.
Yuichi Mitsui, et al.,
bioRxiv - Immunology 2022
Quote:
Human PBMCs were purchased from Precision for Medicine, Inc ...
-
No products found
because this supplier's products are not listed.
Ava P. Soleimany, et al.,
bioRxiv - Bioengineering 2020
Quote:
Fresh frozen human PCa TMAs (BioChain Institute, Inc.; T6235201) were air dried and fixed in ice-cold acetone for 10 minutes ...
-
No products found
because this supplier's products are not listed.
Tommy Tong, et al.,
bioRxiv - Immunology 2023
Quote:
... followed by anti-human IgG AP conjugate (Accurate Chemicals) and were developed using SigmaFast BCIP/NBT ...
-
No products found
because this supplier's products are not listed.
Jorge Gomez-Deza, et al.,
bioRxiv - Neuroscience 2023
Quote:
The Human Genome-Wide CRISPRi Dual-sgRNA Library (Cellecta KIDHGW-105K-P ...
-
No products found
because this supplier's products are not listed.
Greg Tram, et al.,
bioRxiv - Microbiology 2019
Quote:
... 3 µm particle size (Tosoh Biosciences, Tokyo, Japan). Samples were resuspended in buffer B (90% MeCN / 0.1% TFA ...
-
No products found
because this supplier's products are not listed.
Amy L. Kimble, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Frozen mouse and human brain tissues were mechanically homogenized (Next Advance Bullet Blender BB724M with 3.2 mm stainless steel beads using setting 4 for 4min at 4C) ...
-
No products found
because this supplier's products are not listed.
Aya M. Saleh, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 5 mM tris(3-hydroxypropyltriazolylmethyl)amine (THPTA; Click Chemistry Tools), 2 mM copper sulfate ...
-
No products found
because this supplier's products are not listed.
Jiajie Xu, Juan J.L. Guzman, Largus T. Angenent,
bioRxiv - Bioengineering 2020
Quote:
... The increased solution volume in chamber #3 was pumped (Cole-Parmer L/S Digital Economy Drive ...
-
No products found
because this supplier's products are not listed.
Lisa Duvick, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 3-dimensional CT images were analyzed using Imaris 9.8 (Oxford Instruments). Kyphosis index was determined based on where the distance is calculated from a horizontal line drawn from the center of the C7 vertebrae to the center of the pelvis ...
-
No products found
because this supplier's products are not listed.
Kosuke Fukui, et al.,
bioRxiv - Plant Biology 2021
Quote:
... and desalted by Spectra/Por® Dialysis Membrane 3 (Spectrum Labs, USA) with Buffer IV (10 mM NaCl ...
-
No products found
because this supplier's products are not listed.
Anne-Sophie Pépin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 3 kcal/g) or high-fat diet (n=16; HFD; Research Diets Inc. ...
-
No products found
because this supplier's products are not listed.
Duilio M. Potenza, et al.,
bioRxiv - Physiology 2024
Quote:
... and human cardiac fibroblasts was extracted with Trizol Reagent (TR-118, Molecular Research Center) following the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Sebastián Cerminati, et al.,
bioRxiv - Bioengineering 2021
Quote:
Fed-batch fermentations were carried out in 3 L (New Brunswick Bio Flo 115, USA) fermenters ...