-
No products found
because this supplier's products are not listed.
Elvira Nikalayevich, et al.,
bioRxiv - Cell Biology 2021
Quote:
... The following antibodies were used at the indicated concentrations: Human CREST serum (Immunovision, HCT-100, at 1:50 or 1:100), Rabbit poly clonal anti-Rec8 (gift from Scott Keeney ...
-
No products found
because this supplier's products are not listed.
Javier Martínez Pacheco, et al.,
bioRxiv - Plant Biology 2022
Quote:
... Rabbit AtTOR polyclonal antibodies (Abiocode, R2854-2), rabbit polyclonal S6K1/2 antibodies (Agrisera ...
-
No products found
because this supplier's products are not listed.
Yuxuan Han, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... were cultured in Roswell Park Memorial Institute medium (RPMI-1640, Fujifilm Wako Pure Chemical Corporation, Osaka, Japan) supplemented with 10% fetal bovine serum (FBS; Nichirei Biosciences Inc., Tokyo, Japan), 100 U/mL penicillin (Meiji-Seika Pharma Co. ...
-
No products found
because this supplier's products are not listed.
Joseph Chapman, et al.,
bioRxiv - Biochemistry 2019
Quote:
... and stained with 100 μg/mL EM 2-3 monoclonal antibody (Squarix, SQM003.1) (1:300 in 5% BSA ...
-
No products found
because this supplier's products are not listed.
Fangyuan Ding, et al.,
bioRxiv - Systems Biology 2020
Quote:
... were coated with 5 ug/ml Human Fibronectin (Oxford Biomedical Research, Rochester Hills, MI) in PBS buffer for 1hr at room temperature ...
-
No products found
because this supplier's products are not listed.
Konstantinos Kotsaridis, et al.,
bioRxiv - Microbiology 2022
Quote:
... L-methionyl-arginyol-phenylalanylalanine acetate H2O (MRFA, Research Plus, Barnegat, NJ), and perfluoroalkyl triazine (Ultramark 1621 ...
-
No products found
because this supplier's products are not listed.
Clara Taffoni, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... cGAMP enzyme-linked immunosorbent assay (ELISA) was performed according to the manufacturer’s protocol using the Cayman Chemical 2′3′-cGAMP ELISA Kit (Bertin Bioreagents).
-
No products found
because this supplier's products are not listed.
Michael A. Sullivan, et al.,
bioRxiv - Neuroscience 2022
Quote:
... iPSCs were cultured with the addition of 10 ng/mL StemBeads fibroblast growth factor 2 (FGF-2) (StemCultures). Upon reaching 80 % confluency ...
-
No products found
because this supplier's products are not listed.
Andrea Foote, et al.,
bioRxiv - Microbiology 2022
Quote:
... cells were grown overnight as for the 96-well biofilms and then inoculated into 10 ml RWVs (Synthecon Inc., ethanol-sterilized and dried) at a starting inoculum of 0.008 OD600 per species ...
-
No products found
because this supplier's products are not listed.
Michael P. Doyle, et al.,
bioRxiv - Immunology 2022
Quote:
384-well plates were coated with 2 μg/mL of YFV E protein (Meridian Life Science) at 25 μL/well and incubated overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Stephanie H Chen, et al.,
bioRxiv - Genomics 2021
Quote:
... A pilot run on an Illumina iSeq 100 with 2 x 150 bp paired end sequencing run was performed for QC using hic_qc v1.0 (Phase Genomics, 2019) with i1 300 cycle chemistry ...
-
No products found
because this supplier's products are not listed.
Suzan Kors, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 50 μM Phos-tag acrylamide (Wako Chemicals, purchased from NARD Institute ltd.) and 100 μM MnCl2 were added to the resolving gel solution of 8% SDS-PAGE gels before polymerization ...
-
No products found
because this supplier's products are not listed.
Toshiharu Ichinose, et al.,
bioRxiv - Neuroscience 2024
Quote:
... The ribosome-bound mRNA was eluted with 50 µl of 100 µg/ml 3× FLAG peptide (GEN-3XFLAG- 25, Protein Ark) dissolved in the lysis buffer.
-
No products found
because this supplier's products are not listed.
Neil J Rzechorzek, et al.,
bioRxiv - Biochemistry 2020
Quote:
... HEK293-F cells were grown in 400 mL batches in 2 L non-baffled Erlenmeyer flasks (TriForest Enterprises Inc, #FPC2000S) to a cell density of ∼1×106 cells/mL.
-
No products found
because this supplier's products are not listed.
Ting-Yu Lin, et al.,
bioRxiv - Physiology 2022
Quote:
... 7.5% phos-tag gel was used to resolve phosphor-p110α (T1061) (Wako Diagnostics/Chemicals # 192-18001).
-
No products found
because this supplier's products are not listed.
Tyler P. Nicholas, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... or to silver nanoparticles (AgNP; 20 nm, gold-core, citrate-coated, at 1 mg/mL in 2 mM sodium citrate; nanoComposix, San Diego, CA, USA) for an acute exposure of 24 hours ...
-
No products found
because this supplier's products are not listed.
Mengdi Yang, et al.,
bioRxiv - Bioengineering 2022
Quote:
... qRT-PCR was performed in 96-well plates format using FastSYBR Low Rox (CoWin Biosciences) on Quantstudio 3 Real-Time PCR System (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Gwen R. Buel, et al.,
bioRxiv - Biophysics 2022
Quote:
... and incubated with 2 mM DSP (ChemScene CS-0068460 ...
-
No products found
because this supplier's products are not listed.
Wenjing Liu, et al.,
bioRxiv - Pathology 2020
Quote:
... the tissues were incubated with primary antibodies against Wilms tumour-1 (WT1) (1:100, Servicebio, GB11382) and synaptopodin (1:100, ZEN BIO, 508484). The slides were then incubated with HRP-labelled donkey anti-rabbit secondary antibodies ...
-
No products found
because this supplier's products are not listed.
Chandra K. Maharjan, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... frozen plasma was thawed on ice and 5 uL/sample loaded in duplicate wells onto a 96 well plate in Mouse Ultrasensitive Insulin ELISA kit from ALPCO® ...
-
No products found
because this supplier's products are not listed.
Fei Mao, et al.,
bioRxiv - Neuroscience 2021
Quote:
... anti-GAPDH antibody (catalog # 2-RGM2, Advanced ImmunoChemical) was used at 1 μg/mL.
-
Cat# AB-307,
100 micrograms,USD $565.0
Ask
Yue Li, Edmund Hollis II,
bioRxiv - Neuroscience 2021
Quote:
... rabbit anti-p75 (1:100, Advanced Targeting Systems, AB-N01AP), rabbit anti-GFP (1:1500 ...
-
No products found
because this supplier's products are not listed.
Hua He, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... Rabbit anti-ABCA3 (Seven Hills Bioreagents WRAB-70565; 1:100), Rabbit anti-NKX2.1 (Seven Hills Bioreagents WRAB-1231 ...
-
No products found
because this supplier's products are not listed.
Elisa Tonoli, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 30 μg/ml TG2 (Zedira) in ACSF was perfused until plateau of the response was reached ...
-
No products found
because this supplier's products are not listed.
Patrycja Kozik, et al.,
bioRxiv - Immunology 2020
Quote:
... 1×105 MutuDC were seeded in round bottom 96-well plates and incubated for 5h with endotoxin-free OVA (Hyglos #300036) or grade VII OVA (Sigma Aldrich #A7641-250MG) ...
-
No products found
because this supplier's products are not listed.
Jingling Zhao, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and GHb was evaluated every 2 months (Helena Laboratories).
-
No products found
because this supplier's products are not listed.
Daniel Z. Radecki, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Lentivirus pellet was then resuspended in 100□l LentiGuard reagent (Cellomics) and stored at -80⁰C until use ...
-
No products found
because this supplier's products are not listed.
Vipul Sharma, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... and RT All-in-one master mix (Lamda Biotech G208-100). Endpoint PCR was done using EV primers (Forward – CGGCCCCTGAATGCGGCTAATCC ...
-
A flavoprotein (FAD). The bacterium Streptococcus mutans contains two distinct NADH oxidases, a...
Cat# EXWM-1586,
100 ug, contact supplier for pricing
Ask
Junfei Ma, Shuying Wang, Qianyu Ji, Qing Liu,
bioRxiv - Immunology 2021
Quote:
... pylori urease (2 μg in 50 μL, Creative Enzymes, USA) was incubated with purified IgG antibodies (64 μg/well ...
-
No products found
because this supplier's products are not listed.
Thomas H. Q. Powell, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... 96 pupae from each host race were weighed and placed into individual 5ml Norm-JectTM syringes (Air-Tite Products, Virginia Beach, VA, USA) fitted with three-way luer valves (Cole-Parmer ...
-
No products found
because this supplier's products are not listed.
Aurelie Velay, et al.,
bioRxiv - Microbiology 2020
Quote:
... ELISA anti-SARS-CoV-2 IgA and IgG (Euroimmun, Lübeck, Germany) and (2) ELISA-2: EDI™ novel coronavirus COVID-19 IgM and IgG (Epitope Diagnostics, San Diego, CA, USA). Technical characteristics of the assays are summarized in the Supplementary data (Table S1) ...
-
No products found
because this supplier's products are not listed.
Natalie Burchat, et al.,
bioRxiv - Molecular Biology 2024
Quote:
Plasma glucagon-like peptide-1 and -2 (GLP-1 and GLP-2) were measured by ELISA (RayBiotech, Peachtree Corners, Georgia and Crystal Chem, Elk Grove Village, IL, respectively).
-
No products found
because this supplier's products are not listed.
Declan J. Lafferty, et al.,
bioRxiv - Plant Biology 2023
Quote:
... The tissue was filtered using a 100 µM cell strainer (C4100, MTC Bio, USA) and washed with 50 mL sterile deionized water ...
-
No products found
because this supplier's products are not listed.
Carolin Ulbricht, et al.,
bioRxiv - Immunology 2020
Quote:
... or CpG (10 μg/ml, TIB Molbiol Berlin). Cell culture imaging experiments with ionomycin stimulation were performed using an open perfusion chamber system ...
-
No products found
because this supplier's products are not listed.
Jonna Heldrich, et al.,
bioRxiv - Genomics 2020
Quote:
... Samples were immunoprecipitated with 2 μL of either anti-Top2 (TopoGEN, #TG2014), anti-MYC 9E11 (Abcam ...
-
No products found
because this supplier's products are not listed.
Miguel Pineda, et al.,
bioRxiv - Immunology 2021
Quote:
... Collagen-Induced Arthritis (CIA) was induced with bovine type II Collagen (MD Biosciences, 100 mg), injected intradermally (day 0 ...
-
No products found
because this supplier's products are not listed.
Albert S. W. Kang, et al.,
bioRxiv - Biophysics 2020
Quote:
... Purification from excess OsBp was done with spin columns (TC-100 FC from TrimGen Corporation) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Atomu Yamaguchi, et al.,
bioRxiv - Immunology 2023
Quote:
... the pellet was processed with 100 μL of PROPREP reagent (iNtRON Biotechnology Co., Ltd. Japan), followed by incubation on ice for 20 min ...
-
No products found
because this supplier's products are not listed.
Nathan M. Belliveau, et al.,
bioRxiv - Cell Biology 2022
Quote:
... resuspended in 10 mL PolymorphPrep (Cosmo Bio USA #AXS1114683) and added to the bottom of a 50 mL conical tube ...
-
No products found
because this supplier's products are not listed.
Emely V. Zeledon, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
... Meals consisted of 1.5 mL sheep blood (Hemostat Laboratories), saline (400 mM NaHCO3 + dih2O) ...
-
No products found
because this supplier's products are not listed.
Ragna S. Häussler, et al.,
bioRxiv - Biochemistry 2019
Quote:
... the antibody-coupled beads were washed three times in 100 μl 1x PBS (09-9400, Medicago), 0.05% Tween20 (BP337 ...
-
No products found
because this supplier's products are not listed.
Bruno Rafael Barboza, et al.,
bioRxiv - Microbiology 2023
Quote:
... and incubated with primary antibodies: mouse anti-cardiac troponin T (HyTest clone 4T19/2) and rabbit anti-α-actinin (Millipore ...
-
No products found
because this supplier's products are not listed.
Christian P. Rivera, et al.,
bioRxiv - Pathology 2019
Quote:
... 5 mL of Microfil HV 122 Yellow (Flow Tech, Carver, MA) was manually perfused ...
-
No products found
because this supplier's products are not listed.
Emily Speranza, et al.,
bioRxiv - Immunology 2021
Quote:
... slides were de-waxed according to a standard protocol of 2 washes of Xylene (Newcomer Supply) for 10 minutes each ...
-
No products found
Branden A. Smeester, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Blots were thoroughly washed following 2° incubation and developed using the WesternBright Quantum detection kit (Advansta) and the LICOR Odyssey (LICOR) ...
-
No products found
because this supplier's products are not listed.
Aubin Ramon, et al.,
bioRxiv - Bioengineering 2023
Quote:
... SarS-CoV-2 RBD was purchased as biotinylated purified protein from CUSABIO (product code CSB-MP3324GMY1-B) and stored at -80 °C.
-
No products found
because this supplier's products are not listed.
Yukari Nagatoshi, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Samples of 1 to 2 mg were weighed using a microbalance (BM-22; A&D Company Limited, Japan) and analyzed for total N content using an NC analyzer (Series II CHNS/O Analyzer 2400 ...
-
No products found
because this supplier's products are not listed.
Tongjie Wang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... adult C57BL/6 (CD45.1, 8-10 weeks old) recipient mice were irradiated with 2 doses of 4.5Gy (RS 2000, Rad Source) for a 4-hour interval ...
-
No products found
because this supplier's products are not listed.
Bryana N. Harris, et al.,
bioRxiv - Systems Biology 2022
Quote:
Cardiac myocytes were isolated from 1-2-day-old Sprague-Dawley rats using a Neomyt isolation kit (Cellutron, USA). The cells were cultured in plating media (low-glucose Dulbecco’s modified eagle media (DMEM) ...
-
Superoxide dismutase (SOD) is an antioxidant enzyme involved in the defense system against...
Cat# PBCA1050,
Inquiry
Ask
Pragya D Yadav, et al.,
bioRxiv - Microbiology 2021
Quote:
... Pseudovirus (an HIV-based luciferase expressing lentivirus pseudotyped with SARS-CoV-2 full length S protein) was obtained from Creative Biogene. One step luciferase assay kit from BPS Bioscience was used for detection ...