-
No products found
because this supplier's products are not listed.
Kojiro Suda, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Cells were incubated in 98 μl Sorbitol buffer + 2 μl of 2.5 mg/ml Zymolyase 100T (SEIKAGAKU CORPORATION) for 90 min (wild type ...
-
No products found
because this supplier's products are not listed.
Pallavi M. Gosavi, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... CC-885 was purchased from MedKoo Biosciences (98% purity by HPLC) and ZXH-1-161 was a gift from N ...
-
No products found
because this supplier's products are not listed.
Jiao Wang, et al.,
bioRxiv - Immunology 2020
Quote:
... D-Luciferin Potassium Salt (>99%) was purchased from Syd Labs. LY294002 ...
-
No products found
because this supplier's products are not listed.
Sanchita Bhadra, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... SARS-CoV-2 N gene armored RNA was obtained from Asuragen (Austin, TX, USA). SARS-CoV-2 viral genomic RNA was obtained from American Type Culture Collection (Manassas ...
-
No products found
because this supplier's products are not listed.
Darian Williams, et al.,
bioRxiv - Cell Biology 2021
Quote:
Synthetic peptides corresponding to the extracellular domain of PAR1 (AA Ala22-Thr102) and PAR2 (AA Ile26-Thr75) were assembled by automated Fmoc/tBu-solid-phase synthesis (model CS336X; CSBio) followed by cleavage in trifluoroacetic acid (TFA)/phenol/thioanisole/ethanedithiol/water (10:0.75:0.5:0.25:0.5 ...
-
No products found
because this supplier's products are not listed.
Juan A Perez-Bermejo, et al.,
bioRxiv - Genetics 2021
Quote:
... High purity iPS-CM cultures (iCell Cardiomyocytes2, Lot#CMC331743, >99% cTnT+) were obtained from Cellular Dynamics International (Madison ...
-
No products found
because this supplier's products are not listed.
Joana Saldida, et al.,
bioRxiv - Systems Biology 2020
Quote:
... The third set of cultures contained a mixture of 80% unlabelled and 20% uniformly labelled [U-13C] glucose (Buchem, CLM-1396). From each flask ...
-
No products found
because this supplier's products are not listed.
Ugo Tomasello, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... three sections for each brain electroporated at E14.5 with pUB6-TOM and pSilencer-U6-scram (number of brains, n = 4) or pSilencer-U6-miR-137 (number of brains, n = 4) and injected with retrobeads (Lumafluor) at P9 ...
-
No products found
because this supplier's products are not listed.
Kaitlin Morse, Sarah Swerdlow, Elçin Ünal,
bioRxiv - Molecular Biology 2023
Quote:
... The crosslinking reaction was quenched with 125 mM glycine and tubes were gently agitated on a rocker platform (Bellco Biotechnology) at room temperature for 5 min ...
-
No products found
because this supplier's products are not listed.
Sora Kim, et al.,
bioRxiv - Biophysics 2022
Quote:
... The LLYVQRDSKEC-fluorescein N-degron synthetic peptide (21st Century Biochemicals [Marlborough ...
-
No products found
because this supplier's products are not listed.
Adele Stewart, et al.,
bioRxiv - Neuroscience 2022
Quote:
... brains from WT (n=4) and DAT Val559 (n=4) male mice were harvested and stained using the FD Rapid GolgiStain kit (FD Neurotechnologies, cat # PK401, Columbia, MD, USA) per the manufacturer’s instructions[41 ...
-
No products found
because this supplier's products are not listed.
Sammy M. Njenga, et al.,
bioRxiv - Epidemiology 2019
Quote:
... and recombinant measles nucleoprotein (MV-N, Meridian Life Sciences, Memphis, TN) [30] were purchased from commercial sources ...
-
No products found
because this supplier's products are not listed.
Shalini Gupta, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The N- and C-peptides were labeled with maleimide-derivatized DY549P1 (Dyomics), DY649P1 (Dyomics) ...
-
No products found
because this supplier's products are not listed.
David S. Milner, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... 2 Bacteriological (Neogen)] or Scm-his agar (containing CSM-histidine in place of CSM-uracil) ...
-
No products found
because this supplier's products are not listed.
Raquel Bartolome Casado, et al.,
bioRxiv - Immunology 2019
Quote:
... LP and IE (n=5) using the merge and calculation functions of Infinicyt software (Cytognos), as described in detail elsewhere (Pedreira et al. ...
-
No products found
because this supplier's products are not listed.
Jonathan L. Schmid-Burgk, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... using primers and probes against the N-gene (N_Sarbeco_F: CACATTGGCACCCGCAATC, N_Sarbeco_R: GAGGAACGAGAAGAGGCTTG, N_Sarbeco_P: FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ, TIB MolBiol). Spike-in RNA of the bacteriophage MS2 served as an interal control and was detected with Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs ...
-
No products found
because this supplier's products are not listed.
Matthew J. Foulkes, et al.,
bioRxiv - Immunology 2019
Quote:
... The c-Jun N-terminal kinase inhibitor SP600125 was obtained from StressMarq Biosciences (Victoria, Canada), and tanshinone IIA (TIIA ...
-
No products found
because this supplier's products are not listed.
Maria Calvo-Rodriguez, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and incubated with target antibodies at 4C o/n (GFP (1:500, Antibodies Incorporated Cat# GFP-1020, RRID:AB_10000240), HSP60 (1:200 ...
-
No products found
because this supplier's products are not listed.
Nisha Dhanushkodi, et al.,
bioRxiv - Immunology 2022
Quote:
... HSV-2 DNA copy number was determined using purified HSV-2 DNA (Advanced Biotechnologies, Columbia, MD) and based on a standard curve of the CT values ...
-
No products found
because this supplier's products are not listed.
Miguel Alejandro Lopez-Ramirez, et al.,
bioRxiv - Biochemistry 2019
Quote:
... 2-hydroxy-1-naphthaldehyde (Ark Pharm); and 2-amino-N-(1-phenylethyl)benzamide (Enamine).
-
Yuxin Duan, et al.,
bioRxiv - Biophysics 2022
Quote:
... (Waltham, MA) N-hydroxyl succinimide-5 kDa PEG-biotin (NHS-PEG-biotin, HE041024-5K) was purchased from Biochempeg (Watertown, MA). 3-Aminopropyl triethoxysilane (APTES ...
-
No products found
because this supplier's products are not listed.
Nobuyuki Oguri, et al.,
bioRxiv - Pathology 2023
Quote:
... 15 mg/kg n=5) was collected using 21-G needles into plastic syringes containing corn trypsin inhibitor (Molecular Innovations, Southfield ...
-
No products found
because this supplier's products are not listed.
Nobuyuki Oguri, et al.,
bioRxiv - Pathology 2023
Quote:
... except that the reactions were started with 300 μM N-benzoyl-L-isoleucyl-L-glutamyl-glycyl-Larginine-p-nitroaniline hydrochloride and its methyl ester (Chromogenix S-2222, Diapharma) and 300 μM Chromogenix S-2366 (Diapharma).
-
No products found
because this supplier's products are not listed.
Yu Han, et al.,
bioRxiv - Biochemistry 2024
Quote:
... Fetal heart and postnatal hearts (n=5 each) were acquired commercially at E17.5 and P1 from Zyagen (San Diego, CA), weighed ...
-
No products found
because this supplier's products are not listed.
Thomas S. McAlear, Susanne Bechstedt,
bioRxiv - Biophysics 2021
Quote:
... polymerase and inserted into a modified pHAT vector containing an N-terminal 6xHis-tag with and without a carboxy-terminal mNeonGreen (Allele Biotech) followed by a Strep-tag II (Bechstedt and Brouhard ...
-
No products found
because this supplier's products are not listed.
Christian Franke, et al.,
bioRxiv - Cell Biology 2020
Quote:
High precision microscopy coverslips (round, 25 mm in diameter; Marienfeld) in Teflon holders (Wash-N-Dry Coverslip Rack; Diversified Biotech Inc.) were cleaned by incubation at 56°C overnight in 2% Hellmanex III (Hellma Analytics ...
-
No products found
because this supplier's products are not listed.
Christopher J. Emig, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... SARS-CoV-2 Delta Variant pseudovirus (eEnzyme) was diluted 1:2 in DMEM complete media to a pseudoviral particle concentration of 5e7/ml ...
-
No products found
because this supplier's products are not listed.
Kathleen M. Mulvaney, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... pICln guide 2 was acquired from Cellecta in vector pRSG17 ...
-
No products found
because this supplier's products are not listed.
Andrea M. Chambers, et al.,
bioRxiv - Immunology 2021
Quote:
... 500 IU/mL IL-2 (Akron Biotech), 50 ng/mL hIL-21 (Gold Bio) ...
-
No products found
because this supplier's products are not listed.
Ryan J. Garrigues, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 2% C1q-depleted serum (LP; Complement Technologies), or 20% NHS (AP ...
-
No products found
because this supplier's products are not listed.
José Antonio Valer, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... BYL719 at 2 or 10 μM (Chemietek) and 2 nM BMP6 (R&D ...
-
No products found
because this supplier's products are not listed.
Sebastian Schaefer, et al.,
bioRxiv - Microbiology 2023
Quote:
... 2-(butylthiocarbonothioylthio)propanoic acid (BTPA, Boron Molecular) and 5,10,15,20-tetraphenyl-21H,23H-porphine zinc (ZnTPP ...
-
No products found
because this supplier's products are not listed.
Aswini Panigrahi, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Anti-Sulf-2 monoclonal antibodies (QED Bioscience), Anti-LG3BP monoclonal antibody (Proteintech) ...
-
No products found
because this supplier's products are not listed.
Megan L. Schaller, et al.,
bioRxiv - Physiology 2024
Quote:
... Slides were stained in Hematoxylin (Gill’s 2x) (RICCA) for 2 minutes and dipped 1-2 times in bluing solution (ScyTek Laboratories). The slides were next counterstained in eosin and dehydrated using washes of 95% ethanol ...
-
No products found
because this supplier's products are not listed.
Fei Mao, et al.,
bioRxiv - Neuroscience 2021
Quote:
... anti-GAPDH antibody (catalog # 2-RGM2, Advanced ImmunoChemical) was used at 1 μg/mL.
-
Appearance: White powder, neutral odor, highly hygroscopic;Identification: TLC: Standard...
Cat# COP35,
1KG : USD $1000
Ask
Jonathan H. Shrimp, et al.,
bioRxiv - Biochemistry 2020
Quote:
Recombinant Human TMPRSS2 protein expressed from Yeast (human TMPRSS2 residues 106-492, N-terminal 6x His-tag) (Cat # TMPRSS2-1856H) was acquired from Creative BioMart (Shirley, NY). Peptides obtained from Bachem include ...
-
No products found
because this supplier's products are not listed.
Jingling Zhao, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and GHb was evaluated every 2 months (Helena Laboratories).
-
No products found
because this supplier's products are not listed.
Ulri N. Lee, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and 2 g of Yeast Extract (United States Biological Corporation ...
-
No products found
because this supplier's products are not listed.
Ruth I. Connor, et al.,
bioRxiv - Immunology 2023
Quote:
... Omicron BA.1 or Omicron BA.2 (Immune Technology) diluted to 5 μg/ml in 1X PBS and incubated overnight at 4 °C ...
-
No products found
because this supplier's products are not listed.
Shuo Yang, et al.,
bioRxiv - Microbiology 2022
Quote:
... anti-SARS-CoV-2-ORF3a (1:250; 101AP, FabGennix International Inc), anti-Actin (1:500 ...
-
No products found
because this supplier's products are not listed.
Jonna Heldrich, et al.,
bioRxiv - Genomics 2020
Quote:
... Samples were immunoprecipitated with 2 μL of either anti-Top2 (TopoGEN, #TG2014), anti-MYC 9E11 (Abcam ...
-
No products found
because this supplier's products are not listed.
Daniel Abebayehu, et al.,
bioRxiv - Bioengineering 2022
Quote:
... fibroblasts were cultured on 2 kPa polyacrylamide hydrogels that were purchased from Matrigen and came chemically activated ready to bind matrix proteins ...
-
No products found
because this supplier's products are not listed.
Brady G. Anderson, et al.,
bioRxiv - Systems Biology 2023
Quote:
Fecal samples were weighed into pre-tared 2 mL Precellys® (Bertin Corp.) compatible vials ...
-
No products found
because this supplier's products are not listed.
Amanda J. Stock, et al.,
bioRxiv - Immunology 2024
Quote:
... and 2-mercaptoethanol) at 37°C in a Jitterbug Microplate Shaker (Boekel Scientific). After 30 minutes (min ...
-
No products found
because this supplier's products are not listed.
Hannah L. Bernstein, et al.,
bioRxiv - Neuroscience 2023
Quote:
... using a 25-gauge butterfly needle attached to a peristaltic pump (#Minipuls 2; Rainin). Brains were removed and postfixed overnight at 4°C and then cut into 50 µm coronal sections using a vibratome (#TPI1000 ...
-
No products found
because this supplier's products are not listed.
J. Graham Ruby, et al.,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
... Animal cages were changed every 2 weeks within a cage change station (NuAire, Plymouth, MN). Mice were transferred between cages using red transparent acrylic tunnels (Bio-Serv ...
-
No products found
because this supplier's products are not listed.
Kendall Carrasco, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 5 nL of compounds were dispensed (2 x 2.5 nL fixed dispensing using an Echo550 (Labcyte)) from a concentration stock of 1 mM (100% DMSO ...
-
No products found
because this supplier's products are not listed.
Aubin Ramon, et al.,
bioRxiv - Bioengineering 2023
Quote:
... SarS-CoV-2 RBD was purchased as biotinylated purified protein from CUSABIO (product code CSB-MP3324GMY1-B) and stored at -80 °C.
-
No products found
because this supplier's products are not listed.
Tongjie Wang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... adult C57BL/6 (CD45.1, 8-10 weeks old) recipient mice were irradiated with 2 doses of 4.5Gy (RS 2000, Rad Source) for a 4-hour interval ...
-
No products found
because this supplier's products are not listed.
Wen Lu, Margot Lakonishok, Vladimir I Gelfand,
bioRxiv - Cell Biology 2023
Quote:
... The DNA plasmid of pScarlessHD-5’ msps homology arm-C-3xVHH05-6XMS2-DsRed-3’ msps homology arm was co-injected with pCFD5-gRNA#1 and pCFD5-gRNA#2 by BestGene. Flies with fluorescent red eyes were selected and crossed with Tub-PBac flies to remove the DsRed region by PBac transposase ...