-
No products found
because this supplier's products are not listed.
Michael A. Sullivan, et al.,
bioRxiv - Neuroscience 2022
Quote:
... iPSCs were cultured with the addition of 10 ng/mL StemBeads fibroblast growth factor 2 (FGF-2) (StemCultures). Upon reaching 80 % confluency ...
-
Cat# AB-316,
100 micrograms,USD $550.0
Ask
Savannah Barnett, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Hcrt-SAP (hypocretin-2-saporin, Advanced Targeting Systems, San Diego, CA, USA). The method of stereotaxic injection was similar to those described in our previous study and will be brief here (Nattie et al. ...
-
No products found
because this supplier's products are not listed.
Andrea Foote, et al.,
bioRxiv - Microbiology 2022
Quote:
... cells were grown overnight as for the 96-well biofilms and then inoculated into 10 ml RWVs (Synthecon Inc., ethanol-sterilized and dried) at a starting inoculum of 0.008 OD600 per species ...
-
No products found
because this supplier's products are not listed.
Soner Sonmezoglu, et al.,
bioRxiv - Bioengineering 2021
Quote:
... tris-(Bathophenanthroline) Ruthenium (II) Perchlorate (Ru(dpp)3(ClO4)2) (CAS 75213-31-9; GFS Chemicals), were immobilized on the surface of silica particles with a diameter of 10 µm (CAS 7631-86-9 ...
-
No products found
because this supplier's products are not listed.
Samuel X. Shi, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Brain slices (2 mm) were consecutively sectioned coronally using a stainless-steel mouse brain matrix (Roboz Surgical Instrument Co. ...
-
No products found
because this supplier's products are not listed.
Qianying Zuo, et al.,
bioRxiv - Cancer Biology 2022
Quote:
IN SITE Metastasis Kit (Xylyx Bio, Inc., NY) containing TissueSpec Bone (MTSBN101) ...
-
No products found
because this supplier's products are not listed.
Léa Pinon, et al.,
bioRxiv - Synthetic Biology 2024
Quote:
... FujiFilm collagen I (LabChem Wako, Collagen-Gel Culturing Kit) has been used to obtain the 2.4 mg/ml solution ...
-
No products found
because this supplier's products are not listed.
Richard J. Burt, et al.,
bioRxiv - Cancer Biology 2023
Quote:
A double-stranded RNA ELISA kit (Exalpha/Nordic Mubio) was used to quantify dsRNA from 1ug of total RNA ...
-
No products found
because this supplier's products are not listed.
Anuj kumar Murmu, et al.,
bioRxiv - Genomics 2022
Quote:
The predicted peptide sequence of Mucin 2 of indigenous duck was derived by Edit sequence (Lasergene Software, DNASTAR) and then aligned with the peptide of other chicken breed and avian species using Megalign sequence Programme of Lasergene Software ...
-
No products found
because this supplier's products are not listed.
Nishith M Shrimali, et al.,
bioRxiv - Pathology 2021
Quote:
... and incubated with collagen (10 µg/ml) or ADP (2 µM, both from the Bio/Data Corporation, USA) 10 minutes ...
-
No products found
because this supplier's products are not listed.
Matthew D. Kerr, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 1-bicyclo[2.2.1]hept-5-en-2-ylmethanamine (norbornene amine) was purchased from Matrix Scientific (# 038023, lot: M15S). Cy5-tetrazine amine was purchased from Lumiprobe (lot ...
-
No products found
because this supplier's products are not listed.
Arthur J. Jallet, Arnaud Le Rouzic, Anne Genissel,
bioRxiv - Evolutionary Biology 2019
Quote:
... 50 mL of frozen cell suspension were lyophilized for 3 days (LYOVACTM GT 2-E freeze dryer, Steris) and ground in liquid nitrogen to a fine powder with a mortar and pestle ...
-
No products found
because this supplier's products are not listed.
Charles E. Mackay, et al.,
bioRxiv - Physiology 2021
Quote:
... Arterial segments 1-2 mm in length were cannulated at each end in a perfusion chamber (Living Systems Instrumentation) continuously perfused with PSS and maintained at 37°C ...
-
No products found
because this supplier's products are not listed.
Kyla D Omilusik, et al.,
bioRxiv - Immunology 2021
Quote:
... 1-1.5 mg of protein lysate was incubated with Id2 (9-2-8, CalBioeagents) or Id3 (6-1, CalBioreagents) antibody overnight at 4°C followed by protein A/G agarose beads (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Wilfred A. Jefferies, et al.,
bioRxiv - Immunology 2023
Quote:
... or LNP-B.1.617.2 (Delta) spike protein variant of the SARS-CoV-2 virus (Cat # PM-LNP-12) mRNA purchased from Promab Biotechnologies ...
-
No products found
because this supplier's products are not listed.
Gregory M Wright, et al.,
bioRxiv - Cell Biology 2023
Quote:
... FISH was performed using probes for the MT locus in 16q12.2 (56,396,107 to 56,782,063 on chromosome 16 in GRCh37) and chromosome 16 α-satellite purchased from Oxford Gene Technology, who performed paired-end sequencing to verify the identity of the BACs ...
-
No products found
because this supplier's products are not listed.
Raza Ali Naqvi, Araceli Valverde, Afsar Naqvi,
bioRxiv - Immunology 2023
Quote:
... Gene expression was examined using PCR array plate containing 88 primer sets directed against human NF-κB pathway genes and 8 housekeeping primer sets (Real Time Primers, LLC Elkins Park, PA). Briefly ...
-
No products found
because this supplier's products are not listed.
Jared O. Kroll, et al.,
bioRxiv - Biochemistry 2023
Quote:
... streptavidin enrichment and tryptic digestion were performed as previously described.58 Peptides (25 μL) were transferred to 200 μL volume AQ brand silanized glass vial inserts in 2 mL glass autosampler vials (MicroSolv) and stored at −20 °C.
-
No products found
because this supplier's products are not listed.
Jared M. Fischer, et al.,
bioRxiv - Bioengineering 2024
Quote:
... whole blood (10 µL) was mixed with 2 mM EDTA (10 µL) and analyzed using the HemaVet 950S (Drew Scientific).
-
No products found
because this supplier's products are not listed.
Sarah M. Zimmerman, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... The igScript First Strand cDNA Synthesis Kit (Intact Genomics Cat# 4314) was used to synthesize the cDNA with the following modification ...
-
No products found
because this supplier's products are not listed.
David Jukam, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Eggs were irradiated by placing the 6 cm petri dish in a dark chamber for 2 minutes under a 500 Watt Hg arc lamp (Oriel Instruments) producing a downward facing focused beam with diameter of ∼8 cm such that every egg in the dish was covered by the UV light ...
-
No products found
because this supplier's products are not listed.
Christopher D. Pull, et al.,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
We measured the foraging success of individual bees on exiting and re-entering the colony using weight-averaging scales for moving subjects (mean of three repeat measurements with 2s averaging and accuracy of ± 2 mg; Advanced portable balance Scout STX123 120g; OHAUS Corporation) and their lifetime foraging activity and survival using an RFID system (MicroSensys GmBH ...
-
No products found
because this supplier's products are not listed.
Sara Castagnola, et al.,
bioRxiv - Genomics 2020
Quote:
... was performed before cutting the brains sagittally in six equally thick sections (2 mm) using a mouse brain matrix slicer (CellPoint Scientific) and 5 razorblades ...
-
No products found
because this supplier's products are not listed.
Shuyong Jia, et al.,
bioRxiv - Bioengineering 2020
Quote:
... The classic LDFs of both control points (points 1 and 2) were recorded by a PeriFlux 5000 (Perimed AB, Stockholm, Sweden) system with a 64-Hz sampling rate ...
-
No products found
because this supplier's products are not listed.
Shengyun Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...
-
No products found
because this supplier's products are not listed.
Dennis Alejandro Escolástico-Ortiz, et al.,
bioRxiv - Microbiology 2023
Quote:
... followed by 1 h at 45°C and 2 h at 65°C in a heating block digestion system (DigiPREP, SCP Sciences). After digestion ...
-
No products found
because this supplier's products are not listed.
Anne Tersteegen, et al.,
bioRxiv - Immunology 2021
Quote:
Total DNA was isolated from tissues using a DNA isolation kit (Genekam) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Nora Hartig, Kathrin M. Seibt, Tony Heitkam,
bioRxiv - Plant Biology 2022
Quote:
... PCR products were purified (As One International,Invisorb Spin DNA Extraction Kit) and ligation into pGEM-T plasmids (ThermoFisher Scientific ...
-
No products found
because this supplier's products are not listed.
Cristina Godinho-Silva, et al.,
bioRxiv - Immunology 2019
Quote:
... Whole-mount samples were incubated overnight or for 2 days at 4°C using the following antibodies: anti-Tyrosine hydroxylase (TH) (Pel-Freez Biologicals) and anti-GFP (Aves Labs) ...
-
No products found
because this supplier's products are not listed.
Stanimir S. Ivanov, et al.,
bioRxiv - Microbiology 2021
Quote:
The human monocytic cell line U937 (ATCC CRL-1593.2) was obtained from ATCC and primary human peripheral monocytic cells (PBMCs) from two different donors were purchased from Precision for Medicine. U937 cells were cultured in RPMI 1640 media (VWR ...
-
No products found
because this supplier's products are not listed.
Rio Ikuta, Yuu Kakinohana, Shun Hamada,
bioRxiv - Neuroscience 2023
Quote:
... the nuclei were labeled with 4’,6-diamidino-2-phenylindole (DAPI, 1 μg/mL) and then coverslipped with a mounting medium (Fluoroshield Mounting Medium; ImmunoBioScience, CA, USA). Images were obtained using a fluorescence microscope (Eclipse E800 ...
-
No products found
because this supplier's products are not listed.
Roberto Balbontín, Nelson Frazão, Isabel Gordo,
bioRxiv - Microbiology 2020
Quote:
... In the competitions including the RNase HI inhibitor 2-[[[3-Bromo-5-(2-furanyl)-7-(trifluoromethyl)pyrazolo[1,5-a]pyrimidin-2-yl]carbonyl]amino]-4,5,6,7-tetrahydro-benzo[b]thiophene-3-carboxylic acid ethyl ester (RHI001, Glixx Laboratories Inc., catalog number GLXC-03982), the medium was supplemented with 500 µM of RHI001 ...
-
No products found
because this supplier's products are not listed.
Anouschka S. Ramsteijn, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Cages were enriched with wooden stick for gnawing (10×2×2cm) and nesting material (Enviro-dri™, Shepherd Specialty Papers, Richland, MI, USA), and were cleaned weekly ...
-
No products found
because this supplier's products are not listed.
Chan Cao, et al.,
bioRxiv - Biophysics 2023
Quote:
... EBCs were lysed and further treated using the Hemovoid kit (Biotech Support Group), aiming to remove hemoglobin (the most abundant protein in RBCs ...
-
No products found
because this supplier's products are not listed.
Tyler P. Nicholas, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... or to silver nanoparticles (AgNP; 20 nm, gold-core, citrate-coated, at 1 mg/mL in 2 mM sodium citrate; nanoComposix, San Diego, CA, USA) for an acute exposure of 24 hours ...
-
No products found
because this supplier's products are not listed.
Thomas Rowe, et al.,
bioRxiv - Microbiology 2024
Quote:
... 180 uL of HEK-λ cells were added to each well containing twenty uL of sample and to serially 1/2-log diluted (0.1 – 1000 ng/mL) recombinant ferret IFNL3 (Kingfisher Biotech, St. Paul, MN, USA). The plates were incubated for 20Hr at 37°C ...
-
No products found
because this supplier's products are not listed.
Yumaine Chong, Ellis Cooper,
bioRxiv - Neuroscience 2022
Quote:
... was injected into the anterior chamber of the eye using a 33G x 1/2” TSK SteriJect hypodermic needle (Air-Tite Products, Virginia Beach, VA) fitted onto a 25μL Gastight Hamilton syringe (Hamilton Company ...
-
No products found
because this supplier's products are not listed.
Benedict Edward Mc Larney, et al.,
bioRxiv - Cancer Biology 2022
Quote:
The fluorescence emission spectra of pHLIP ICG was assessed in the presence of and without POPC (1-Palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine) liposomes (100nm in size, T&T Scientific Corp, TN, USA). pHLIP ICG has previously shown a high NIR fluorescent state when bound to liposomes and low NIR fluorescent state without the presence of liposomes enabling in vitro testing.(47 ...
-
No products found
because this supplier's products are not listed.
Carmen RB da Silva, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... The volumetric flow rates produced by the flow controllers was measured using a Gilian Gilibrator–2 NIOSH Primary Standard Air Flow Calibrator with a low–flow cell (Sensidyne, LP, St Petersburg, FL, USA) and corrected to standard temperature pressure ...
-
No products found
because this supplier's products are not listed.
Walker D. Short, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... HA concentration was confirmed in the extracted samples with a Hyaluronic Acid test kit (Corgenix Specialists in ELISA & IVD Diagnostic Technology ...
-
No products found
because this supplier's products are not listed.
Yuqian Jiang, et al.,
bioRxiv - Bioengineering 2020
Quote:
... A temperature-controlled oil bath (Instatherm® Economy Bath/Controller Kit, Ace Glass, Inc., VWR, USA) equipped with a type J thermocouple temperature sensor was employed to control the heat treatment temperature ...
-
No products found
because this supplier's products are not listed.
Veronica Ferrucci, et al.,
bioRxiv - Genetics 2020
Quote:
... Real-time RT-PCR was performed using ‘RealQquality RQ-2019-nCoV’ kits (Ab Analitica; IVD approved) for detection of the RdRp and E genes (from the SarsCov2 N gene) ...
-
No products found
because this supplier's products are not listed.
Tamás Bakos, et al.,
bioRxiv - Immunology 2024
Quote:
... Soluble terminal C complex (sTCC, sC5b9) was measured with an ELISA kit from Svar Life Science AB (Malmö ...
-
No products found
because this supplier's products are not listed.
Kristina Haslinger, et al.,
bioRxiv - Biochemistry 2020
Quote:
... we used the TR-FRET Bridge-It® S-Adenosyl Methionine (SAM) Fluorescence Assay Kit from Mediomics LLC (St ...
-
No products found
because this supplier's products are not listed.
Aggeliki Tserga, et al.,
bioRxiv - Systems Biology 2021
Quote:
... Urinary albumin concentration was measured by ELISA using the AlbuWell kit (WAK-Chemie Medical GmbH, Steinbach, Germany). Urinary creatinine concentration was measured by the colorimetric method of Jaffe ...
-
No products found
because this supplier's products are not listed.
Bettina Budeus, et al.,
bioRxiv - Immunology 2022
Quote:
... IGHV gene rearrangements were amplified using the LymphoTrack IGH FR1 Assay kit (InvivoScribe, San Diego, CA, USA). Amplified DNA was processed for HTSeq according to the LymphoTrack protocol ...
-
No products found
because this supplier's products are not listed.
Filipy Borghi, et al.,
bioRxiv - Physiology 2021
Quote:
... 4 °C and analyzed using the commercial ELISA kit (Diagnostics Biochem Canada Inc. - Ref CAN-C-290) at the Laboratory of Stress Studies (LABEEST ...
-
No products found
because this supplier's products are not listed.
Hongji Yan, et al.,
bioRxiv - Bioengineering 2019
Quote:
The sialic acid removal assay was conducted by using Neuraminidase immobilized on slurry (GlycoCleave Neuraminidase kit, GALAB technologies). Briefly ...
-
No products found
because this supplier's products are not listed.
Uli Schmitz, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... The HBeAg and HBsAg ELISAs were performed using the HBeAg ELISA kit (International Immuno-Diagnostics, Foster City, CA) and HBsAg ETI-MAK-2 plus kit (DiaSorin ...
-
No products found
because this supplier's products are not listed.
Rosalia Emma, et al.,
bioRxiv - Biochemistry 2022
Quote:
... the bacterial suspensions were immediately used for AMES screening by following manufacturer’s protocol (Salmonella Mutagenicity Test Kit, MOLTOX®). Briefly ...