-
No products found
because this supplier's products are not listed.
Mohit P. Mathew, et al.,
bioRxiv - Cell Biology 2021
Quote:
... anti-Ezrin (Cell Signaling) and anti-galectin 3 (ThermoFisher) ...
-
No products found
because this supplier's products are not listed.
Jonathan Perr, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-EZR (Santa Cruz Biotechnology, sc-58758 AF647), anti-ꞵ2M (Santa Cruz Biotechnology ...
-
No products found
because this supplier's products are not listed.
Dhiraj Indana, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... Ezrin (Sigma-Aldrich E8897), Podocalyxin (R&D systems MAB1658) ...
-
No products found
because this supplier's products are not listed.
Xiao Huang, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and anti-Ezrin (Abcam #ab4069) were used for specific immunostaining ...
-
No products found
because this supplier's products are not listed.
Wendy K. Duan, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... and anti-Ezrin (Invitrogen; Burlington ...
-
No products found
because this supplier's products are not listed.
Christian Hartmann, et al.,
bioRxiv - Cell Biology 2021
Quote:
... mouse mAb anti-Ezrin (BD-TL #610602), rabbit mAb anti-Phospho-Thr567-Ezrin (CST #3726) ...
-
No products found
because this supplier's products are not listed.
Xarxa Quiroga, et al.,
bioRxiv - Biophysics 2021
Quote:
... mEmerald-Ezrin was from Addgene (#54090). EGFP-IRSp53-FL (62) ...
-
No products found
because this supplier's products are not listed.
E. Angelo Morales, et al.,
bioRxiv - Cell Biology 2021
Quote:
... The human ezrin sequence was cloned into a pEGFP-N1 (Clontech; 6085-1). The human MISP and EGFP-MISP sequences were subcloned into modified pFastBac-6xHis-MBP plasmid LIC expression vector (Addgene ...
-
No products found
because this supplier's products are not listed.
Alexander Popov, et al.,
bioRxiv - Neuroscience 2022
Quote:
... for 1 h at room temperature and then incubated overnight at 4°C either with primary mouse antibodies for Ezrin (EZR, Antibodies-Online, catalog number ABIN5542456 ...
-
No products found
because this supplier's products are not listed.
Meriem Belabed, et al.,
bioRxiv - Immunology 2023
Quote:
Human: Anti-human CD141 (clone M80, BioLegend), anti-human CD45RA (clone HI100 ...
-
No products found
because this supplier's products are not listed.
Samuel J. Ghilardi, et al.,
bioRxiv - Cell Biology 2021
Quote:
... the Ezrin Inhibitor NSC668394 (50 μM, Calbiochem), Y27632 (25 μM ...
-
No products found
because this supplier's products are not listed.
Alexander Popov, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Ezrin was visualized using 3,3’-diaminobenzidine from the DAB+ kit (Agilent, Santa Clara, USA). Then ...
-
No products found
because this supplier's products are not listed.
Florent Peglion, et al.,
bioRxiv - Cell Biology 2021
Quote:
... human FGF-basic and human EGF (animal free, Peprotech) at 20 ng/mL ...
-
No products found
because this supplier's products are not listed.
Aina Badia-Soteras, et al.,
bioRxiv - Neuroscience 2022
Quote:
... we inserted the designed sgRNA to target exon-1 of Ezrin (TGGCTGGTTGGTGGCTCTGCGTGGGT) (Genscript: NM_001271663.1_T3). Finally ...
-
No products found
because this supplier's products are not listed.
Valeriya Malysheva, et al.,
bioRxiv - Genetics 2022
Quote:
... anti-human-CD19 and anti-human-CD14 (Miltenyi Biotec) and transferred through LD columns (Miltenyi Biotec ...
-
No products found
because this supplier's products are not listed.
Parker C. Wilson, et al.,
bioRxiv - Genomics 2022
Quote:
Human primary proximal tubular cells (human RPTEC, Lonza; CC-2553) were cultured with renal epithelial cell growth medium kit (Lonza ...
-
No products found
because this supplier's products are not listed.
Julia Prigann, et al.,
bioRxiv - Microbiology 2023
Quote:
... Human NK cell or Human Monocyte CD14+ Isolation kits (STEMCELL Technologies), respectively ...
-
No products found
because this supplier's products are not listed.
Johanna Straube, et al.,
bioRxiv - Immunology 2023
Quote:
... recombinant human PD-L1 human IgG1 Fc chimera protein (R&D Systems), or mouse IgG1 isotype antibodies (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Ali Akbar Karkhaneh Yousefi, et al.,
bioRxiv - Biophysics 2023
Quote:
... using 10% Human Fn (Human Fn, Promocell) in PBS ...
-
No products found
because this supplier's products are not listed.
Danica M. Sutherland, et al.,
bioRxiv - Microbiology 2021
Quote:
... Human cDNA (Origene) of NgR1 (NM_023004) ...
-
No products found
because this supplier's products are not listed.
Qing Zhao, et al.,
bioRxiv - Immunology 2023
Quote:
Biotinylated Goat F(ab)2 anti-human isotype antibodies (anti-human IgM, SouthernBiotech, Cat # 2022-01; anti-human IgA, SouthernBiotech, Cat # 2052-01 ...
-
No products found
because this supplier's products are not listed.
M A Bashar Emon, et al.,
bioRxiv - Biophysics 2020
Quote:
... namely fibronectin (Human, Corning) and laminin (Human ...
-
No products found
because this supplier's products are not listed.
Zhongyu Zou, et al.,
bioRxiv - Cell Biology 2022
Quote:
... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339, human METTL3: QIAGEN SI05020414 and human DDX6 ...
-
No products found
because this supplier's products are not listed.
David Knorr, et al.,
bioRxiv - Immunology 2023
Quote:
... and human FcyRs (human FCGR2A #10374-H08H, human FCGR2B #10259-H08H, human FCGR3A #10389-H08H, Sino Biological). 96 well ELISA Half Area High Binding plates (Greiner Bio-One ...
-
No products found
because this supplier's products are not listed.
Aurélien Pasturel, et al.,
bioRxiv - Bioengineering 2019
Quote:
... Human Fibronectin (Roche). Agar low melting point ...
-
No products found
because this supplier's products are not listed.
Yi-min Cheng, et al.,
bioRxiv - Physiology 2019
Quote:
... human tubal fluid (HTF) medium and human serum albumin (HSA) (Merck Millipore Corporation ...
-
No products found
because this supplier's products are not listed.
Gemma E. Hartley, et al.,
bioRxiv - Immunology 2023
Quote:
... Serially diluted recombinant human IgG1 or human IgG4 (BioRad, Hercules, CA) with unrelated specificities were used for quantification in separate wells on the same plate.
-
No products found
because this supplier's products are not listed.
Shu Liu, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Human primary astrocytes (ScienCell) were cultivated as recommended by ScienCell ...
-
No products found
because this supplier's products are not listed.
Christoph B. Messner, et al.,
bioRxiv - Systems Biology 2020
Quote:
... Human cell lysate (MS Compatible Human Protein Extract, Digest, V6951) were purchased from Promega.
-
No products found
because this supplier's products are not listed.
Andrew J Kinloch, et al.,
bioRxiv - Immunology 2020
Quote:
... Alexa Fluor 488 goat anti-human IgG and anti-human IgG HRP (Jackson ImmunoResearch).
-
No products found
because this supplier's products are not listed.
Christine Chiasson-MacKenzie, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The shRNA constructs targeting mouse ezrin (5’-ATTTCCTTGTTATAATCTCCG-3’) in a pLKO-puro.1 vector from GE Healthcare and described in27 ...
-
No products found
because this supplier's products are not listed.
Raeann Goering, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Primary antibodies with various dilutions (Ezrin, Cell Signaling Technology 3145S, 1:250; NaK ATPase, DSHB A5-s, 1:50; TOM20, ProteinTech 11802-1-AP, 1:250) were diluted in PBS containing 1% BSA and 0.3% Triton-X for 1 hr at 37°C ...
-
No products found
because this supplier's products are not listed.
Denis D. Shi, et al.,
bioRxiv - Bioengineering 2023
Quote:
... human albumin (Bethyl Laboratories ...
-
No products found
because this supplier's products are not listed.
Anthony A. Ruberto, et al.,
bioRxiv - Genomics 2021
Quote:
... primary human hepatocytes (BioIVT) were seeded 2-3 days prior to infection with 15,000-20,000 sporozoites per well ...
-
No products found
because this supplier's products are not listed.
Jelke J. Fros, et al.,
bioRxiv - Microbiology 2021
Quote:
... Human blood (Sanquin Blood Supply Foundation ...
-
No products found
because this supplier's products are not listed.
Shivneet K. Gill, et al.,
bioRxiv - Biochemistry 2024
Quote:
... Dilutions of human serum (Human Serum age 4-6, Innovative Research) were performed in TBSM ...
-
No products found
because this supplier's products are not listed.
V. E. Dunlock, et al.,
bioRxiv - Immunology 2019
Quote:
... anti-human CD3 (OKT3, Bio X cell, anti-human CD28 (9.3 Bio X Cell), anti-human CD45 (REA747 ...
-
No products found
because this supplier's products are not listed.
Huan Shu, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Human/Mouse/Rat (Illumina, discontinued), and fragmented by incubating with PNK buffer (NEB ...
-
No products found
because this supplier's products are not listed.
Viviane M. Andrade, et al.,
bioRxiv - Immunology 2021
Quote:
... (MabTech, Human IFNγ ELISpot Plus). Cells were then washed off ...
-
No products found
because this supplier's products are not listed.
Tom Snelling, et al.,
bioRxiv - Immunology 2022
Quote:
... and human IL-1β (Invivogen), were dissolved in PBS and added to the cell culture medium to achieve final concentrations of 10 μM (ADP-heptose) ...
-
No products found
because this supplier's products are not listed.
Fynn M. Hansen, et al.,
bioRxiv - Systems Biology 2020
Quote:
HEK293 (human, DMSZ, ACC 635) and U2OS (human, American Type Culture Collection [ATCC], HTB-96) cell were cultivated in DMEM (Gibco ...
-
No products found
because this supplier's products are not listed.
Philipp Licht, Volker Mailänder,
bioRxiv - Systems Biology 2024
Quote:
... human (E6320, New England Biolabs, USA) and sequenced on a MiSeq (Illumina ...
-
No products found
because this supplier's products are not listed.
Jesper Huitfeld Jespersen, et al.,
bioRxiv - Cell Biology 2023
Quote:
SkMel2-ezrin-GFP cells grown in 10cm diameter dishes (VWR) to 80-90% confluency were treated with the indicated agents in medium for 24 hours ...
-
No products found
because this supplier's products are not listed.
Yuan Wang, et al.,
bioRxiv - Cancer Biology 2020
Quote:
Human CD40 (Acrobiosystems), GITR (Acrobiosystems) ...
-
No products found
because this supplier's products are not listed.
Kevin P. Foley, et al.,
bioRxiv - Physiology 2020
Quote:
... Human insulin (Mercodia) and human C-peptide (Millipore ...
-
No products found
because this supplier's products are not listed.
Richard J Mills, et al.,
bioRxiv - Cell Biology 2021
Quote:
Human CNTI ELISA (RayBiotech), IFN-γ (RnD Systems ...
-
No products found
because this supplier's products are not listed.
Senthil A. Visaga, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... Human FPR2 antibodies (Novus Biologicals) for FPR2 expression analysis or and goat-anti-rabbit IgG HRP (Cell Signaling Technology ...
-
No products found
because this supplier's products are not listed.
Redouane Aherrahrou, et al.,
bioRxiv - Genetics 2023
Quote:
... Human aortic SMCs (Cell Applications, Inc. ...
-
No products found
because this supplier's products are not listed.
Xiaoxuan Zhuang, et al.,
bioRxiv - Immunology 2023
Quote:
... containing 10% human serum (Valley Biomedical) and were used within 4 days ...
-
No products found
because this supplier's products are not listed.
Michael J. Pereira, et al.,
bioRxiv - Microbiology 2021
Quote:
... Normal human serum (Complement Technologies) was diluted to 2.3% (v/v ...