-
No products found
because this supplier's products are not listed.
Lucie Olejníková-Ladislavová, et al.,
bioRxiv - Animal Behavior and Cognition 2024
Quote:
The 5-HT2A antagonist (R)-(+)-α-(2,3-Dimethoxyphenyl)-1-[2-(4-fluorophenyl)ethyl]-4-piperinemethanol (M100907; Sigma Aldrich) at a dose of 0.5 mg/kg.
-
No products found
because this supplier's products are not listed.
James Pelletier, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5 micromols sodium sulfo-NHS and 5 micromols 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) (Thermo Fisher #22980) in 10 μL of DMSO ...
-
No products found
because this supplier's products are not listed.
Mélanie Rogier, et al.,
bioRxiv - Immunology 2020
Quote:
... IL-4 (5 ng/ml; Peprotech) and an anti-CD40 antibody (200 ng/ml ...
-
No products found
because this supplier's products are not listed.
Stefan Mielke, et al.,
bioRxiv - Plant Biology 2020
Quote:
Approximately 5 000 seeds (0.1 g) of kor1-4 JGP were mutagenized with ethyl methanesulfonate (EMS, Sigma) as described (6) ...
-
No products found
because this supplier's products are not listed.
Jaakko Haverinen, Minna Hassinen, Matti Vornanen,
bioRxiv - Physiology 2021
Quote:
... L-364,373 (R-L3 or 5-(2-Fluorophenyl)-1,3-dihydro-3-(1H-indol-3-ylmethyl)-1-methyl-2H-1,4-benzodiazepin-2-one) (Tocris Cookson; Bristol, UK) and mefenamic (dimethylphenylaminobenzoic ...
-
No products found
because this supplier's products are not listed.
Clara R. Stelman, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ...
-
No products found
because this supplier's products are not listed.
Haiqi Xu, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... 5 μl 4× Template Switching RT buffer (NEB), 1 µl of 75 μM T7-TSO (5’-/5Biosg/ACTCTAATACGACTCACTATAGGGAGAGGGCrGrGrG-3’) ...
-
No products found
because this supplier's products are not listed.
Laila Shehata, et al.,
bioRxiv - Immunology 2023
Quote:
... 5 ug of recombinant mouse IL-4 (BioLegend) was diluted to 150 uL with sterile PBS and administered i.v ...
-
No products found
because this supplier's products are not listed.
Julius Brandenburg, et al.,
bioRxiv - Immunology 2020
Quote:
... was used to solubilize N-(1-(2′-(4-Isopropoxyphenoxy)-2,5’-bithiazol-5-yl)ethyl)acetamide (“ACC2 inhibitor 1”; ab142090; purchased from Abcam, Cambridge, UK), 5-[1’-(1-cyclopropyl-4-methoxy-3-methylindole-6-carbonyl)-4-oxospiro[3H-chromene-2,4’-piperidine]-6-yl]pyridine-3-carboxylic acid (“ACC2 inhibitor 2” known as MK-407439 ...
-
No products found
because this supplier's products are not listed.
Guilherme S. Hentschke, et al.,
bioRxiv - Microbiology 2021
Quote:
... 4 μl 5× Buffer (Promega), 2 μl MgCl2 (25mM) ...
-
No products found
because this supplier's products are not listed.
Helen M. Gooch, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 4-amino pyridine (5 mM, Merck) and TTX (0.5-1 μM ...
-
No products found
because this supplier's products are not listed.
Stephanie S. Kim, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Cells were grown to 70% confluent in 24-well plates prior to treatment with N-[2-[[3-(4-Bromophenyl)-2-propenyl]amino]ethyl]-5-isoquinolinesulfonamide dihydrochloride (H89; R&D Systems) or 3-(1,3-Benzodioxol-5-ylmethylene)-2-oxo-1-pyrrolidinecarboxaldehyde (KNK437 ...
-
No products found
because this supplier's products are not listed.
Liang Wang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
No products found
because this supplier's products are not listed.
Adeline Pastuszka, et al.,
bioRxiv - Microbiology 2024
Quote:
... Bacteria are centrifuged (5 min, 5 000 rpm, pre-cooled 4°C, Eppendorf 5430R) and pellets washed two times (500 mM sucrose ...
-
No products found
because this supplier's products are not listed.
Corina M. Stewart, et al.,
bioRxiv - Microbiology 2022
Quote:
... 5-(N-ethyl-N-isopropyl)-Amiloride (EIPA, Cayman Chemical), and Akt Inhibitor VIII (Cayman Chemical ...
-
No products found
because this supplier's products are not listed.
Xin Tong, et al.,
bioRxiv - Immunology 2024
Quote:
... 5% L-glutamine (Corning, 4 mM), 5% HEPES buffer (pH 7.2 ...
-
No products found
because this supplier's products are not listed.
Ayşe Kılıç, et al.,
bioRxiv - Systems Biology 2023
Quote:
... anti–IL-4 (5 µg/mL; BD Biosciences); Th2 cells ...
-
No products found
because this supplier's products are not listed.
Anne D. Villela, et al.,
bioRxiv - Microbiology 2020
Quote:
... Membranes were washed three times with 1X PBS for 5 min and developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in alkaline phosphatase buffer (Bio-Rad).
-
No products found
because this supplier's products are not listed.
Abhishek Kumar Verma, et al.,
bioRxiv - Microbiology 2024
Quote:
4-5 months old C57BL/6N mice (Charles River Laboratories) were used in all studies ...
-
No products found
because this supplier's products are not listed.
Yang Wang, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 4 μL of NiSO4 (5 mM, VWR) was added for further 5-min incubation ...
-
No products found
because this supplier's products are not listed.
Antonio Astorga-Gamaza, et al.,
bioRxiv - Immunology 2024
Quote:
... for 4 hours and 5 mM ATP (Santa Cruz Biotechnology ...
-
No products found
because this supplier's products are not listed.
Matheus Silvério Mattos, et al.,
bioRxiv - Immunology 2023
Quote:
... A 5 ml protein G Sepharose 4 Fast flow column (GE Healthcare) was used to extract total human IgG ...
-
No products found
because this supplier's products are not listed.
Anthony Flamier, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and passaging every 4-5 days using ReLeSR (StemCell technologies). hES-qualified Matrigel (Corning ...
-
No products found
because this supplier's products are not listed.
Dannielle K. Zierath, et al.,
bioRxiv - Neuroscience 2023
Quote:
... mice (4–5 weeks old; Jackson Labs, Bar Harbor, ME) were group-housed throughout the infection and monitoring period (5/cage) ...
-
No products found
because this supplier's products are not listed.
Eric T. Hall, et al.,
bioRxiv - Cell Biology 2020
Quote:
... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...
-
No products found
because this supplier's products are not listed.
Rajprasad Loganathan, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... embryos were fixed in 4% glutaraldehyde (Polysciences; Cat#18428-5) and 2% acrolein (Sigma ...
-
No products found
because this supplier's products are not listed.
Fatmanur Tiryaki, et al.,
bioRxiv - Cell Biology 2021
Quote:
... for 5 minutes at 4°C with TLA100 rotor (Beckman). 100 µg cell lysate was brought to a final volume of 250 µl BRB80 supplemented with 1 mM GTP ...
-
No products found
because this supplier's products are not listed.
Konstadinos Moissoglu, et al.,
bioRxiv - Cell Biology 2020
Quote:
... sgRNAs targeting RABIF (sg #2: 5’-GAGCGAGTTAGTGTCAGCCGAGG-3’ and sg #4 5’-AGCGAGTTAGTGTCAGCCGAGGG-3’) were cloned in lentiCRISPRv2 (Addgene #52961). MDA-MB-231 cells were infected with the corresponding lentiviruses and selected with 1μg/ml puromycin (Thermo Fisher Scientific).
-
No products found
because this supplier's products are not listed.
Aidan C. Daly, et al.,
bioRxiv - Systems Biology 2024
Quote:
... 5’ amine-modified DNA oligonucleotides (5’-[AmC6]dUdUdUdUd-[Illumina_adaptor]-[spatial barcode]-[UMI]-[20T]-VN ...
-
No products found
because this supplier's products are not listed.
Victoria Mamontova, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... for 5 min at 4°C and lysates were sonicated (1x 5 min, 30 sec on/off) with a Bioruptor (Diagenode) followed by digestion with 40U RNaseI (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Yeying Huang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Samples were fixed with 4% paraformaldehyde for 5 minutes and blocked in 5% goat normal serum (Cell Signaling Technologies, 5425) for an hour before antibody detection using antibodies listed in Supplementary Tables S5-S6 ...
-
No products found
because this supplier's products are not listed.
Sallieu Jalloh, et al.,
bioRxiv - Microbiology 2024
Quote:
... Caspase-4 (cells were transfected with ultra-pure LPS (5 μg/ml, InvivoGen) for 6 hrs ...
-
No products found
because this supplier's products are not listed.
Diego J. Páez-Moscoso, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 4 cm of 5-μm strong cation exchange resin (Luna; Phenomenex), and 8 cm of reverse-phase C18 resin57 ...
-
No products found
because this supplier's products are not listed.
Robert M. Cox, et al.,
bioRxiv - Microbiology 2020
Quote:
... 100 µM of 5’-phosphorylated 4-nt primer ACCA (Perkin Elmer) and 5% DMSO containing ERDRP-0519 at the specified concentration ...
-
No products found
because this supplier's products are not listed.
Chris Y. Cheung, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Cell nucleus was defined and exposed to 405 nm laser light for 4-5 times 200ms bursts at ∼5% 405 nm laser power (TCS SP8 MP, Leica). After photoconversion of Dendra2-RUVBL2 ...
-
No products found
because this supplier's products are not listed.
Matthew J. Burke, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
No products found
because this supplier's products are not listed.
Anthony Lanahan, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Selection for pyrF mutations was performed with 5-fluoroorotic acid (5-FOA, Zymo Research, part number F9001-5) at a final concentration of 0.5 mg/ml ...
-
No products found
because this supplier's products are not listed.
Zohreh Izadifar, et al.,
bioRxiv - Bioengineering 2024
Quote:
... human liver endothelial cells (LECs) (Lonza HLECP1; 4-5×106 cells/ml) were first loaded in the basal channel followed by seeding of human Huh7 hepatocytes (Sekisui JCRB0403-P ...
-
No products found
because this supplier's products are not listed.
Steven Tau, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Plates were imaged every 3-4 d on a Cytation 5 (BioTek) with 4x magnification and phase contrast ...
-
No products found
because this supplier's products are not listed.
Alexia Polissidis, et al.,
bioRxiv - Neuroscience 2021
Quote:
For GBA quantification (n=5 for 4 WPI, n=3 for 8 WPI), the surface function of the Imaris software was used to select only GFP-positive cells by appropriately adjusting the number of voxels as well as the intensity of the GFP channel in the threshold tab ...
-
No products found
because this supplier's products are not listed.
GaYoung Park, et al.,
bioRxiv - Bioengineering 2024
Quote:
... hydrogels of varying Young’s modulus: 5 kPa (4% 20 kDa 4-arm PEG-NB, Creative PEGworks; 2 mM RGD, Genscript), 12 kPa (5% 40 kDa 8-arm PEG-NB ...
-
No products found
because this supplier's products are not listed.
Helen Barbas, et al.,
bioRxiv - Neuroscience 2024
Quote:
... and preblocked for 1 h at 4°C in 5% normal goat serum (NGS; Vector Laboratories), 5% bovine serum albumin (BSA ...
-
No products found
because this supplier's products are not listed.
Lucía Paniagua-Herranz, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Images were obtained every 5 minutes over 4-5 days using a long-distance 20x phase contrast objective (Nikon), a ZYLA camera (ANDOR ...
-
No products found
because this supplier's products are not listed.
Hattie Chung, et al.,
bioRxiv - Genomics 2021
Quote:
... 5% normal donkey serum and 5% normal goat serum (Jackson Immunoresearch) for 30 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Rebecca J. Hall, et al.,
bioRxiv - Microbiology 2023
Quote:
... an overnight culture was grown in 5 ml LB (E. coli MG1655 recipient) or 5 ml LB (E & O Laboratories Ltd) + 4 µg/ml cefotaxime (Alfa Aesar) (donors ...
-
No products found
because this supplier's products are not listed.
Pedro L. Moura, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... at 4°C and distributed at 5 mL per LS column (Miltenyi Biotec), or 5×106 BM MNC were thawed ...
-
No products found
because this supplier's products are not listed.
Ziqing Liu, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5 x 105 passage 4 HUVEC were seeded onto µ channel slides (ibidi, 80176) coated with 5 µg/ml human plasma fibronectin (Roche ...
-
No products found
because this supplier's products are not listed.
Francesco Roncato, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Images were acquired at a rate of one frame every 4-5 min for 4 h using an IX83 inverted microscope (Olympus) equipped with UPlanFLN 20x/0.50 Ph1 ∞/0.17/FN 26.5 objective (Olympus) ...
-
No products found
because this supplier's products are not listed.
Danyang Zhang, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Data were acquired and filtered (at 5 kHz 4-pole Bessel filter) with MultiClamp 700B amplifier (Molecular Devices), digitized with Digidata 1440A (Molecular Devices ...
-
No products found
because this supplier's products are not listed.
Jakub Netolicky, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Borosilicate glass micropipettes with a tip resistance of ∼4-5 MΩ were prepared using a P-1000 puller (Sutter Instruments) and then filled with an intracellular recording solution containing (in mM ...