-
No products found
because this supplier's products are not listed.
Henriette Hoffmann-Veltung, et al.,
bioRxiv - Immunology 2022
Quote:
... 100 µL of either goat anti-mouse IgG (for 6E2 hybridoma cells) or mouse anti-human IgG (for EBV-immortalized human B cells) specific for the Fc region (Mabtech) diluted in sterile PBS at 15 µg/mL were added to wells followed by incubation at 4°C for 24 hours ...
-
No products found
because this supplier's products are not listed.
Biana Bernshtein, et al.,
bioRxiv - Immunology 2023
Quote:
... Antigen-coupled microspheres were washed and incubated with plasma samples at an appropriate sample dilution (1:50 for Isotypes and 1:100 for all Fc-receptors) for 2 hours at 37°C in 384-well plates (Greiner Bio-One). Unbound antibodies were washed away ...
-
No products found
because this supplier's products are not listed.
Haizhang Chen, et al.,
bioRxiv - Immunology 2020
Quote:
... or a PE-TexasRed-conjugated human IgG-Fc fragment (Rockland) for 1h at 4°C in PBS/3%FCS ...
-
No products found
because this supplier's products are not listed.
Stephan Brinkmann, et al.,
bioRxiv - Microbiology 2021
Quote:
... cathepsins B and L (CatB, CatL; human liver, Calbiochem) and α-chymotrypsin (α-CT ...
-
No products found
because this supplier's products are not listed.
Jun-yi Zhu, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... raised against human polyubiquitin-B and polyubiquitin-C (1:100) (BML-PW8810, Enzo Life Sciences); Rabbit polyclonal antibody against protein disulfide isomerase (1:100 ...
-
No products found
because this supplier's products are not listed.
Justin E. LaVigne, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... CHO cells stably expressing the human CB1 receptor were obtained from PerkinElmer (#ES-110-C) and utilized for western blots (CB1-CHO-C2 ...
-
No products found
because this supplier's products are not listed.
Sevinç Gücüm, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... supplemented with 1 % FCS (PAN Biotech) and 1 % Pen/Strep under 5 % CO2 at 37 °C ...
-
No products found
because this supplier's products are not listed.
Yamini Ravichandran, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Human FGF-b (RayBiotech) was also added to the medium at 10 ng/ml for the first four days of culture ...
-
No products found
because this supplier's products are not listed.
Caroline Koch, et al.,
bioRxiv - Biophysics 2022
Quote:
... B-type natriuretic peptide (4095916, Bachem, Switzerland); cardiac troponin I (Z03320 ...
-
No products found
because this supplier's products are not listed.
J. Drube, et al.,
bioRxiv - Cell Biology 2021
Quote:
... human complement 5a receptor 1 (C5aR1) with C5aR-agonist (AnaSpec AS65121, in measuring buffer), human muscarinic 1,2,3,4 ...
-
No products found
because this supplier's products are not listed.
Stacia M. Nicholson, Francis A.X. Schanne,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Fc receptors were blocked for 30 min with Protein A (MP Biomedicals, OH) in Stain Buffer (554656 ...
-
No products found
because this supplier's products are not listed.
Anthony D Fenton, et al.,
bioRxiv - Microbiology 2023
Quote:
... Lentiviruses for transduction of LTR-mCherry reporter and expression of HIV receptors (CD4, CXCR4, and CCR5) was generated by transfection of HEK293 cells using the Mirus TransIT transfection kit (Mirus). The resulting supernatant was cleared of debris by low-speed centrifugation (300g for 5 minutes ...
-
No products found
because this supplier's products are not listed.
Wilton B. Williams, et al.,
bioRxiv - Immunology 2020
Quote:
... while human B cells were CD38+/- (Beckman Coulter #6699531; 1µl per test) and CD19 (BD #557791 ...
-
No products found
because this supplier's products are not listed.
Thomas Geuens, et al.,
bioRxiv - Bioengineering 2020
Quote:
... type 6a1 collagen (GTX109963, Genetex, 1:300), α-Smooth muscle actin (aSMA ...
-
No products found
because this supplier's products are not listed.
Kung-Hsien Ho, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Wild-type CD-1 (ICR) mice were from Charles River Laboratories (Wilmington ...
-
No products found
because this supplier's products are not listed.
Jenny Horndahl, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Pittman 576, type b (Culture Collection University of Gothenburg, Gothenburg, Sweden) was grown over night in Brain-heart infusion media (VWR, Radnor, PA, USA) at 37°C ...
-
No products found
because this supplier's products are not listed.
Albert Chun Shuo Huang, et al.,
bioRxiv - Immunology 2022
Quote:
... and anti-receptor activator of nuclear factor-kappa B ligand (RANKL) (dilution ratio: 1:400) (Bioss, Woburn, MA). After deparaffinization and rehydration ...
-
No products found
because this supplier's products are not listed.
MT Heemskerk, et al.,
bioRxiv - Immunology 2021
Quote:
... diluted in PBS for 10 min at RT and Fc-receptors were subsequently blocked using 5% human serum (HS; Sanquin Blood bank, Amsterdam, The Netherlands) for 45 min at RT ...
-
No products found
because this supplier's products are not listed.
Erik Procko,
bioRxiv - Biochemistry 2020
Quote:
Hydrated anti-human IgG Fc biosensors (Molecular Devices) were dipped in expression medium containing RBD-IgG1 for 60 s ...
-
No products found
because this supplier's products are not listed.
Jillian M. DiMuzio, et al.,
bioRxiv - Immunology 2021
Quote:
... HEK293 cells expressing human Angiotensin converting enzyme 2 (ACE2) (BPS Biosciences, Cat #79951) were cultured in EMEM containing 10% FBS and 5 mg/mL Puromycin to select for ACE2-expressing cells ...
-
No products found
because this supplier's products are not listed.
Fangzhou Lou, et al.,
bioRxiv - Immunology 2020
Quote:
... Normal Human Epidermal Keratinocytes (NHEKs; Lifeline Cell Technology, cat. FC-0007) stored in liquid nitrogen were defrosted and cultured in serum-free basal medium with growth factors (Lifeline Cell Technology ...
-
No products found
because this supplier's products are not listed.
Alonso J. Pardal, Andrew J. Bowman,
bioRxiv - Biochemistry 2022
Quote:
H3.1-/H4-EGFP wild type and mutants (FD, HB) were transfected into HEK293-F cells and seeded onto 8-well µ-slides (ibidi). FRAP experiments were performed using an UltraVIEW VoX Live Cell Imaging System (PerkinElmer ...
-
No products found
because this supplier's products are not listed.
Daniel S. Hassell, et al.,
bioRxiv - Genetics 2021
Quote:
... Hygromycin B (#H-270-1, Gold Biotechnology) was added to YPD at 200 μg/mL ...
-
No products found
because this supplier's products are not listed.
Frederic Fiore, et al.,
bioRxiv - Neuroscience 2022
Quote:
... GABAB receptor antagonist – CGP55845 (5 μM; HelloBio HB0960); adrenergic α1A receptor antagonist – RS17053 (40 μM ...
-
No products found
because this supplier's products are not listed.
Yun-Ruei Kao, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Signals were visualized and collected by LI-COR Odyssey Fc (LI-COR Biosciences). ImageJ (https://imagej.nih.gov/ij/ ...
-
No products found
because this supplier's products are not listed.
Maurice Michel, et al.,
bioRxiv - Biochemistry 2024
Quote:
... goat anti-human IgG-Fc Alexa488 (Dianova, 1:400) or goat antihuman IgM Alexa 594 (Molecular Probes ...
-
No products found
because this supplier's products are not listed.
Adam K. Wade-Vallance, et al.,
bioRxiv - Immunology 2022
Quote:
... αIgE with a mutated Fc-receptor binding domain (clone R1E4; Cedarlane), or control rat gamma globulin were diluted in D-PBS to a concentration of 0.3mg/mL and injected intravenously to achieve a final dose of 3.25mg/kg ...
-
No products found
because this supplier's products are not listed.
Bing Han, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
No products found
because this supplier's products are not listed.
Anjali Gupta, et al.,
bioRxiv - Biophysics 2019
Quote:
FCS measurements were performed on an objective type TIRF microscope (IX-71, Olympus, Singapore) with a high NA oil immersion objective (PlanApo ...
-
Cat# HY-P70381-50 μg,
50 μg, USD $510.0
Ask
Kira Zeevaert, et al.,
bioRxiv - Cell Biology 2022
Quote:
... the EB-medium was supplemented with the TGF-β-Type I-receptor inhibitors SB-431542 (10 μM; MedChemExpress, Monmouth Junction, USA) (Inman et al. ...
-
No products found
because this supplier's products are not listed.
Ravichandra Vemuri, et al.,
bioRxiv - Pathology 2021
Quote:
... and cardia biomarker NT-proBNP (N-terminal pro-B-type natriuretic peptide; MyBiosource, San Diego, CA) via ELISA and following manufacturer instructions as previously described.4 ...
-
No products found
because this supplier's products are not listed.
Navid Paknejad, Vinay Sapuru, Richard K. Hite,
bioRxiv - Biophysics 2022
Quote:
... Membrane proteins were solubilized from 2.4 L of pelleted HEK293S GnTI-cells expressing wild-type hIP3R3 for 2 hours by rotation in 2% lauryl maltose neopentyl glycol (LMNG; Anatrace Cat# NG310), 150 mM sodium chloride (NaCl) ...
-
No products found
because this supplier's products are not listed.
Hiroaki Tsukano, et al.,
bioRxiv - Neuroscience 2019
Quote:
... we used a low-salt type cholera toxin subunit b (CTB) (#104; List Biological Laboratory, Campbell, CA) that is suitable for iontophoretic injection (Ruigrok et al. ...
-
No products found
because this supplier's products are not listed.
Min Zhang, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Immortalized human alveolar epithelial cells (HPAEpiC) were generated from Type II pneumocytes of human lung tissue (purchased form Sciencell Shanghai Corporation) and were maintained in RPMI 1640 medium (Gibco ...
-
No products found
because this supplier's products are not listed.
Rachid EI Fatimy, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... anti-Lamin B (ABclonal, A16685, 1:1000 dilution); anti-CDC42-iso1 (Millipore ...
-
No products found
because this supplier's products are not listed.
Berislav Bošnjak, et al.,
bioRxiv - Immunology 2022
Quote:
... FCS files were analyzed using FCS Express V7 (De Novo Software) or FlowJo V10 (BD).
-
No products found
because this supplier's products are not listed.
Renaud Mevel, et al.,
bioRxiv - Developmental Biology 2020
Quote:
Immunocompetent wild-type ICR (CD-1) mice were purchased from Envigo. P1-Runx1:GFP and P2-Runx1:RFP have been described previously (Draper et al. ...
-
No products found
because this supplier's products are not listed.
Gabrijela Dumbović, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Coverslips were washed with 1 mL of wash buffer B (LGC Biosearch Technologies) for 5 min at RT ...
-
No products found
because this supplier's products are not listed.
Rebecca J. Burge, et al.,
bioRxiv - Microbiology 2020
Quote:
... 100 µM of human wild-type (Boston Biochem) or K63R ubiquitin (2B Scientific ...
-
No products found
because this supplier's products are not listed.
Pawel Stocki, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 100 µl of either a 1:5,000 peroxidase-conjugated anti-human Fc antibody or 1:20,000 streptavidin Poly-HRP40 Conjugate (Fitzgerald) diluted in 0.5% BSA in PBST was added and incubated for 1 hr ...
-
No products found
because this supplier's products are not listed.
Ya-Juan Wang, et al.,
bioRxiv - Cell Biology 2022
Quote:
... or GST-tagged human GABAA receptor β2 subunit protein (GST-β2) (Abnova, catalog #: H00002561-P01) was mixed with 4 μg of recombinant His-tagged human Hsp47 protein (Novus ...
-
No products found
because this supplier's products are not listed.
Simon J. Cleary, et al.,
bioRxiv - Immunology 2024
Quote:
... These sequences were codon-optimized and antibodies were expressed as chimeric hIgG1 with or without Fc point mutations in a HEK293 cell system and purified using protein A and buffer exchange (Absolute Antibody).
-
No products found
because this supplier's products are not listed.
Mariam Taha, et al.,
bioRxiv - Microbiology 2023
Quote:
... b) 500 µL of 10% (v/v) human synovial fluid (BioIVT, Westbury, NY, USA) prepared in sterile Ringer’s solution (37) ...
-
No products found
because this supplier's products are not listed.
Josie L Ferreira, et al.,
bioRxiv - Microbiology 2022
Quote:
... falciparum parasites were cultured in human red blood cells (O+ or B+, Universitätsklinikum Eppendorf, Hamburg, Germany) at 5 % haematocrit in an atmosphere of 1% O2 ...
-
No products found
because this supplier's products are not listed.
Fernando Y. Maeda, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Splenic B-cells were preloaded with SiR-Lysosome (1 µM, Cytoskeleton) in the presence of verapamil (10 µM ...
-
No products found
because this supplier's products are not listed.
Martina Hauke, et al.,
bioRxiv - Microbiology 2023
Quote:
... and 10% FCS (PromoCell, Germany). HEK-NF-κB_luc were supplemented for routine growth with 50 µg/mL Hygromycin B (Invivogen ...
-
No products found
because this supplier's products are not listed.
Loyda M. Morales Rodríguez, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
HEK293 cells were plated onto 25mm coverslips (Electron Microscopy Sciences, #50949050) coated with poly-D-lysine (Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
Altair C. Hernandez, et al.,
bioRxiv - Cell Biology 2024
Quote:
● Immersion Oil type F2 (Nikon).
-
No products found
because this supplier's products are not listed.
Miquel Rosas-Salvans, et al.,
bioRxiv - Cell Biology 2021
Quote:
... CREST (1:100, human, Antibodies Incorporated, 15-234-0001), Hec1 (1:200 ...
-
No products found
because this supplier's products are not listed.
Katy Pilarzyk, et al.,
bioRxiv - Neuroscience 2022
Quote:
... including “#1” that detects all PDE11A4 (GAF-B, n=7M,9F; mCherry, n=3M,3F ...