-
No products found
because this supplier's products are not listed.
Farzaneh Mahmoudi-Kordi, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... samples shook again and incubated in hot water bath (IKA, HB digital) at 50°C for 30 min ...
-
No products found
because this supplier's products are not listed.
Anthony L. Shiver, et al.,
bioRxiv - Systems Biology 2020
Quote:
... and 500 µL of this culture was diluted into 35 mL of fresh LB with 100 µg/mL ampicillin in a 250-mL baffled flask and grown in a shaking water bath (Gyrorotory® Water Bath Model G76, New Brunswick Scientific Co., Incorporated) at 32 °C ...
-
No products found
because this supplier's products are not listed.
Scott P. Lawrence, et al.,
bioRxiv - Cell Biology 2021
Quote:
... samples were washed with water and mounted on coverslips with Mowiol 4-88 (Calbiochem). Images were acquired using Nyquist criterion with a Leica TCS SPE confocal system with a 63x ACS APO/ NA 1.3 oil immersion lens and galvanometer driven stage insert and deconvolved using Huygens software.
-
No products found
because this supplier's products are not listed.
Scott H. Saunders, et al.,
bioRxiv - Microbiology 2019
Quote:
... 50 mM NaCl) that was degassed by leaving open in an anaerobic chamber (Coy Lab Products) for at least 3 days.
-
No products found
because this supplier's products are not listed.
Luke W. Boorman, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The heated water component employed a temperature controlled hot water bath (StableTemp 5 litre, Cole-Parmer UK) set at 50°C ...
-
No products found
because this supplier's products are not listed.
Wei Chen, Bing He,
bioRxiv - Developmental Biology 2022
Quote:
... rinsed with water 12 times and mounted in water in a 35 mm MatTek glass-bottom dish (MatTek Corporation). Unless otherwise mentioned ...
-
No products found
because this supplier's products are not listed.
Shuangyuan Guo, et al.,
bioRxiv - Pathology 2021
Quote:
... water was replaced by fresh water (mock) or 10 μM flg22 peptide (Bankpeptide) or 10 μM chitin (Santa Cruz. Biotechnology) for 10 ...
-
No products found
because this supplier's products are not listed.
Lina Muñoz Hoyos, et al.,
bioRxiv - Plant Biology 2023
Quote:
... alternata or water were floated on water in black 96-well plates and chlorophyll fluorescence was measured with a plate reader (Tecan Infinite F200 PRO ...
-
No products found
because this supplier's products are not listed.
Souparno Ghosh, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Animals were warmed using a water-heating pad (Braintree). Heart rate and blood oxygenation saturation level were continuously monitored using an MRI-compatible noninvasive infrared pulse oximeter (Nonin Medical ...
-
No products found
because this supplier's products are not listed.
Oliver Johanndrees, et al.,
bioRxiv - Plant Biology 2021
Quote:
... Four-mm leaf discs from 4th or 5th leaves of 5-week-old Nb plants were washed in double-distilled (mQ) water for 2h and incubated in 200 μl of mQ water in 96-well plates (Greiner Bio-One, #655075) under aluminum foil overnight ...
-
No products found
because this supplier's products are not listed.
Matthew J. White, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 1.1 N.A water-immersion objective and an Evolve EMCCD camera (Photometrics). The traction stress vector fields were generated using an open source package of FIJI plugins (Tseng et al. ...
-
No products found
because this supplier's products are not listed.
Deborah D. Chin, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 100 µM micelle solutions in water were placed on carbon grids (Ted Pella, Redding, CA) and stained with 2 wt% uranyl acetate ...
-
No products found
because this supplier's products are not listed.
Zoe Netter, Drew T. Dunham, Kimberley D. Seed,
bioRxiv - Microbiology 2023
Quote:
... Anaerobic media was degassed overnight and aliquoted into Hungate culture tubes (Chemglass Life Sciences CLS420801) in an anaerobic chamber (Coy Lab Products ...
-
No products found
because this supplier's products are not listed.
Mirna Merkler, Nancy Y Ip, Shuzo Sakata,
bioRxiv - Neuroscience 2023
Quote:
... A water pump (AL-1000, World Precision Instruments) and sound presentation were controlled by a custom-written LabVIEW program (National Instruments) ...
-
No products found
because this supplier's products are not listed.
Gloria Gonzalez Curto, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... NA 1.0 (water immersion) objective and the InSight (LaVision BioTek) image acquisition software ...
-
No products found
because this supplier's products are not listed.
L. Robert Hollingsworth, et al.,
bioRxiv - Immunology 2020
Quote:
... rinsed with water and imaged via Odyssey CLx (LI-COR). Primary antibodies used in this study include ...
-
No products found
because this supplier's products are not listed.
Luca Finetti, et al.,
bioRxiv - Animal Behavior and Cognition 2020
Quote:
... the dsRNA was resuspended in ultrapure water and quantified by Biospec-Nano spectrophotometer ...
-
No products found
because this supplier's products are not listed.
Jiachen Huang, Rose Miller, Jarrod Mousa,
bioRxiv - Immunology 2022
Quote:
... The grid was washed in water twice then stained with Nano-W (Nanoprobes) for 1 min ...
-
No products found
because this supplier's products are not listed.
Nina K. Jain, Pierce J. Ogden, George M. Church,
bioRxiv - Synthetic Biology 2023
Quote:
... Eluates were drop-dialyzed against 30 mL of water for 1 hour and transformed (Lucigen E ...
-
No products found
because this supplier's products are not listed.
Jennifer M. Luppino, et al.,
bioRxiv - Genetics 2022
Quote:
Images for HiDRO experiments were acquired on a Molecular Devices Image Xpress Micro 4 Confocal high-content microscope with 0.42 um pinhole and 1.4 NA 60X water immersion objective (Molecular Devices). Max projections of z-series (6 images ...
-
No products found
because this supplier's products are not listed.
Erin Skeens, et al.,
bioRxiv - Biophysics 2021
Quote:
... the NMR tubes were briefly degassed with nitrogen and sealed with Parafilm (Bemis). The samples were equilibrated in the presence of redox reagents for at least six hours ...
-
No products found
because this supplier's products are not listed.
Weisi Liu, et al.,
bioRxiv - Genomics 2022
Quote:
... Red tinted water bottles (ANCARE) were used during drug administration since BBN is a light-sensitive compound ...
-
No products found
because this supplier's products are not listed.
Line Lomheim, et al.,
bioRxiv - Microbiology 2019
Quote:
... water and methanol (Caledon Laboratory Chemicals), and ethanol (Commercial Alcohols ...
-
No products found
because this supplier's products are not listed.
Seesandra V. Rajagopala, et al.,
bioRxiv - Genomics 2022
Quote:
... and 7.25 μl PCR Certified Water (Teknova). RNA was reverse transcribed at 50ºC for 15 minutes ...
-
No products found
because this supplier's products are not listed.
Makoto Kashima, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 20× in water (Biotium, Fremont, CA, USA), 0.5 µL of 10 µM 5× WGS_Pr_R1-5’ primer (AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTC ...
-
No products found
because this supplier's products are not listed.
Peng Liang, et al.,
bioRxiv - Microbiology 2020
Quote:
... and 6 μL DEPC-treated water (R1600,Solarbio) were mixed together as the PCRs (20 μL).
-
No products found
because this supplier's products are not listed.
Sepiedeh Keshavarzi, et al.,
bioRxiv - Neuroscience 2021
Quote:
... submerged in 1 % Tergazyme (in distilled water, Alconox) for at least an hour ...
-
No products found
because this supplier's products are not listed.
Julia D. Neuhaus, et al.,
bioRxiv - Biochemistry 2021
Quote:
... coupled to a Waters Acquity UPLC M-Class system (Waters, Milford, USA) with a PicoviewTM nanospray source 500 model (New Objective) in DDA mode using an inclusion list20.
-
No products found
because this supplier's products are not listed.
Claudia Feriotti, et al.,
bioRxiv - Microbiology 2021
Quote:
... Recombinant mouse IL-10 ([vehicle solution water] 1ng/ml, Biolegend) was added overnight before infection ...
-
No products found
because this supplier's products are not listed.
James W. Truman, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... The kit solutions were resuspended in UltraPure water (Cayman Chemical). The readings were compared to a standard curve derived from serial dilutions of the 20E standard and quality control provided by the kit.
-
No products found
because this supplier's products are not listed.
Yu-Mi Choi, et al.,
bioRxiv - Plant Biology 2021
Quote:
... Water and n-hexane were purchased from Thomas Scientific (Philadelphia, PA, USA) and Fisher Scientific (Pittsburgh ...
-
No products found
because this supplier's products are not listed.
Abishek Chandrashekar, et al.,
bioRxiv - Microbiology 2022
Quote:
... Slides were then rinsed in distilled water and protein blocked (Biocare, BE965H) for 15 min followed by rinses in 1× PBS ...
-
No products found
because this supplier's products are not listed.
Aline Timmermann, et al.,
bioRxiv - Neuroscience 2021
Quote:
... adding a drop of water to prevent the gel from drying (ibidi chambers and coverslips were poly-lysine coated by incubation with poly-l-lysine solution (0.1% w/v in water (P8920 ...
-
No products found
because this supplier's products are not listed.
Craig T. Connors, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... All sections were rinsed in water and dehydrated in ethanol (Decon Labs), cleared in xylene (Fisher) ...
-
No products found
because this supplier's products are not listed.
Caroline L. Wee, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Embryo water was also constantly circulated through the dish using a peristaltic pump (Harvard Apparatus). The interstimulus interval (ISI ...
-
No products found
because this supplier's products are not listed.
M. Adelfio, et al.,
bioRxiv - Bioengineering 2024
Quote:
... water for three days in a cellulose dialysis tube (3.5 kD MWCO, Spectrum Labs Inc, Rancho Dominguez, CA) for a total of six D.I ...
-
No products found
because this supplier's products are not listed.
Basila Moochickal Assainar, et al.,
bioRxiv - Biophysics 2023
Quote:
... the aliquot with cys-ubiquitin was degassed and incubated with a 2-fold molar excess of Sulfo-Cyanine3 maleimide (Lumiprobe) dissolved in DMSO for 2 hours on ice ...
-
No products found
because this supplier's products are not listed.
David L Gillett, et al.,
bioRxiv - Microbiology 2023
Quote:
... and solutions of isotope labelled glucose and milliQ H2O were degassed via purging with N2 for at least 30 minutes in 12 mL gastight exetainers (Labco Exetainer) and treated using a gas-tight Luer lock 0.25 mL syringes (PhaseSep ...
-
No products found
because this supplier's products are not listed.
Jonathan W. Villanueva, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 98.5% DEPC water) and DEPC water (Amresco, Dallas, TX). RppH (NEB ...
-
No products found
because this supplier's products are not listed.
Idan Shalev, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... UltraPure Water (Rockland), and 100ng DNA in a 10 uL reaction ...
-
No products found
because this supplier's products are not listed.
Noel Anthony Mano, et al.,
bioRxiv - Plant Biology 2020
Quote:
Acidified water was supplemented with water-soluble fertilizer (ICL Specialty Fertilizers, Dublin, OH, USA) to provide the following (in mg L-1) ...
-
No products found
because this supplier's products are not listed.
Nathaniel P. Skillin, et al.,
bioRxiv - Bioengineering 2023
Quote:
... 300 µL of 0.1% gelatin in water (StemCell Technologies) was added to the coverslips and NanoSurface dishes ...
-
No products found
because this supplier's products are not listed.
Aires Januário Fernandes da Moura, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... 18 μl of water and 2 μl TaqαI enzyme (NZYTech) at 10U/ μl ...
-
No products found
because this supplier's products are not listed.
Nicholas J Saner, et al.,
bioRxiv - Physiology 2020
Quote:
... deionised water and a protease/phosphatase inhibitor cocktail (Cell Signaling Technology (CST), Danvers ...
-
No products found
because this supplier's products are not listed.
Dhanasak Dhanasobhon, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The signal was amplified (IR-183; Cygnus Technology, Delaware Water Gap, PA), filtered at 0.3 to 3 kHz (Brownlee amplifier ...
-
No products found
because this supplier's products are not listed.
John A. Gaynes, et al.,
bioRxiv - Neuroscience 2021
Quote:
... (a gift from Loren Looger, Addgene plasmid # 98929; http://n2t.net/addgene:98929; RRID:Addgene_98929; 1013 vg/mL in water) was injected into the vitreous humour of wild type mice (C57BL/6J ...
-
No products found
because this supplier's products are not listed.
Sarah M Pearsall, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... using a 25X water lens and Z-stacks (40-150 µm) were reconstructed using Imaris Imaging software (Oxford Instruments).
-
No products found
because this supplier's products are not listed.
Jing Guang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... A single feeding dose equals ∼30 cc water and 50-70 cc of Ensure Plus (Abbott Laboratories, Abbott Park, Illinois), a high calorie (1.5 Kcal/cc ...
-
No products found
because this supplier's products are not listed.
Yue Qu, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 46 nL/23 ng of cRNA or equal volumes of RNase-free water were injected into oocytes with a Nanoinject II microinjector (Drummond Scientific). Oocytes were incubated for 48 h in Calcium Ringer’s solution (96 mM NaCl ...
-
No products found
because this supplier's products are not listed.
Alvin C.Y. Kuk, et al.,
bioRxiv - Biochemistry 2019
Quote:
... then treated with 1 uL of sodium 2-sulfonatoethyl methanethiosulfonate (MTSES, Anatrace, 10x stock in water) to a working concentration of 100 uM ...