-
No products found
because this supplier's products are not listed.
Jian An, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 10 µL anti-MSH3 antibody (Bethyl Labs anti-MSH3 A305-314A) and 5 µL Control Rabbit IgG (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Thomas O’Brien, et al.,
bioRxiv - Genetics 2024
Quote:
... and probed with primary antibodies Msh3 primary antibody (BD Biosciences ...
-
No products found
because this supplier's products are not listed.
J Ferreira da Silva, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... MSH3 (ab69619, Abcam), Tubulin (3873 ...
-
No products found
because this supplier's products are not listed.
Zhikun Wu, et al.,
bioRxiv - Genetics 2021
Quote:
... DNA repair was performed using NEBNext FFPE DNA Repair Mix (M6630L, NEB). End repair was performed using NEBNext Ultra II End Repair/dA-Tailing Module (E7546L ...
-
No products found
because this supplier's products are not listed.
Jinzhen Guo, Wei Yang, Guo-Min Li,
bioRxiv - Molecular Biology 2024
Quote:
... The resulting HeLa-(CAG)45 MSH3-KO clones expressing individual MSH3 isoforms were screened with 10ug/ml puromycine (Sigma) and verified by Western blotting analysis for successful MSH3 rescue.
-
No products found
because this supplier's products are not listed.
Xue-Ke Zhao, et al.,
bioRxiv - Genomics 2021
Quote:
IHC staining of four mismatch repair (NMR) proteins: MLH1 (1: 100, PA5-32497, Thermo Fisher Scientific), MSH2 (1 ...
-
No products found
because this supplier's products are not listed.
Shuai Liu, et al.,
bioRxiv - Genomics 2022
Quote:
... Repair ends of DNA using End-It DNA End-Repair Kit (Lucigen, Cat. ER0720), then perform A-tailing with Klenow Fragment (3’-> 5’ exo- ...
-
No products found
because this supplier's products are not listed.
Jillian Belgrad, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 10 µg of protein were first separated by SDS-PAGE and then blotted with the following antibodies: MSH3 (1:500, Santa Cruz, sc-271080), huntingtin (1:2,000 ...
-
No products found
because this supplier's products are not listed.
Gergely Rona, et al.,
bioRxiv - Cell Biology 2024
Quote:
MSH3 (1:1000, Proteintech 22393-1-AP)
-
No products found
because this supplier's products are not listed.
Natasja L. de Vries, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Mismatch repair status was assessed by standard protocol for the Ventana automated immunostainer for MLH1 clone M1 (Roche), MSH2 clone G219-1129 (Roche) ...
-
No products found
because this supplier's products are not listed.
Sarah G. Aldous, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Tissue homogenisation and western blotting was performed with 50 μg of total protein as previously described.15 Membranes were incubated overnight with gentle agitation at 4 °C with the MSH3 antibody (Merck MSH3MAB(1F6)) in 5% milk PSB-T (phosphate buffer saline (PBS) ...
-
No products found
because this supplier's products are not listed.
Gabriela Leite, et al.,
bioRxiv - Cell Biology 2021
Quote:
AllPrep DNA/RNA/Protein Mini Kits (Qiagen) were used to extract total proteins from UVA-exposed and non-exposed HTEpC from all experiments ...
-
No products found
because this supplier's products are not listed.
Adi Amar-Schwartz, et al.,
bioRxiv - Cancer Biology 2022
Quote:
The mismatch repair assay was performed as described previously57 using plasmids pGEM5Z (+)-EGFP (Addgene, cat #65206) and p189 (Addgene ...
-
No products found
because this supplier's products are not listed.
Shuhe Tsai, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Antibody-bound DNA was recovered using the Protein A or Protein G magnetic beads (Bio-Rad), washed similarly as DRIP samples and treated with Proteinase K and RNAse after elution ...
-
No products found
because this supplier's products are not listed.
Takaaki Yasuhara, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The repair products were amplified from genomic DNA using Ex-Taq (Takara) and cloned into the pCR2.1 vector (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Wei Yang, Junjun Cao, David G. McVey, Shu Ye,
bioRxiv - Genetics 2023
Quote:
... The chromatin DNA-protein complexes were incubated with an anti-MeCP2 antibody (Cell Signaling Technology, 3456) or an isotype control antibody (Abcam ...
-
No products found
because this supplier's products are not listed.
Lovisa Stenström, et al.,
bioRxiv - Cell Biology 2020
Quote:
DNA repair outcomes were characterized by Illumina amplicon Sequencing ...
-
No products found
because this supplier's products are not listed.
Kevin P. Kotredes, et al.,
bioRxiv - Neuroscience 2023
Quote:
... A single-stranded DNA repair construct (synthesized by Genscript) with the sequence 5’- CTGGGCTGACAAACATCAAGACGGAAGAGATCTCGGAAGTGAAGATGGATGCAGA ATTCCGACATGATTCAGGATATGAAGTCCATCATCAAAAACTGGTAGGCAAAAATAAACTGCCTCTCCCCGAGATTGCGTCTGGCCAGATGAAAT-3’ was used to introduce the G601R ...
-
No products found
because this supplier's products are not listed.
Yang Liu, et al.,
bioRxiv - Genomics 2022
Quote:
Antibody-derived DNA tags for membrane proteins were purchased from Biolegend and listed in Table S5 ...
-
No products found
because this supplier's products are not listed.
Ben C. Calverley, Karl E. Kadler, Adam Pickard,
bioRxiv - Cell Biology 2020
Quote:
... 1 μg of repair template was transfected into 200,000 cells using a 3:1 ratio Fugene6:DNA (Promega), after overnight transfection cells were grown in fresh medium for 6 hours ...
-
No products found
because this supplier's products are not listed.
Olha Puhach, et al.,
bioRxiv - Microbiology 2020
Quote:
... Proteins of interest were detected with protein-specific primary antibodies and HRP-coupled secondary antibodies by enhanced chemiluminescence (GE Healthcare) and imaged using X-ray films or with Fusion Capture Advance FX7 16.15 (Peqlab).
-
No products found
because this supplier's products are not listed.
Juliana Soares, et al.,
bioRxiv - Biophysics 2020
Quote:
... polyclonal antibody against glial fibrillary acidic protein (GFAP) (Dako, Denmark) and for oligodendrocytes ...
-
No products found
because this supplier's products are not listed.
Gianluca Mucciolo, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Proteins were detected using HRP-conjugated secondary antibodies (Jackson ImmunoResearch Laboratories).
-
No products found
because this supplier's products are not listed.
Andrew Santiago-Frangos, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and the DNAs were purified away from protein using a DNA Clean & Concentrator kit (Zymo Research). Both 5’ ends of 1 pmole of the CRISPR leader and array fragments were then labelled with 32P ...
-
No products found
because this supplier's products are not listed.
Vlada V. Zakharova, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... The DNA-protein-antibody complexes were captured by DiaMag protein A-coated magnetic beads (Diagenode; Cat#: C03010020) by incubating at 4 °C for 2 hours ...
-
No products found
because this supplier's products are not listed.
M. Vega-Sendino, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... End-repair reaction was cleaned using AMPure XP beads (Beckman Coulter) and eluted in 16.5 μl of Elution Buffer (10 mM Tris-HCl pH 8.5 ...
-
No products found
because this supplier's products are not listed.
Karim Ullah, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Hif2α and ARNT protein-DNA complexes were immunoprecipitated using antibodies against Hif2α (No. NB100-122, Novus Biologicals, USA), ARNT (D28F3 ...
-
No products found
because this supplier's products are not listed.
Hirotatsu Imai, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Antibodies against ribosomal proteins uL3 (GTX114725, GeneTex), L10a (A305-061A ...
-
No products found
because this supplier's products are not listed.
Deepika Vasudevan, et al.,
bioRxiv - Genetics 2021
Quote:
... proteins were detected using primary antibodies and IRDye-conjugated secondary antibodies (LI-COR) on the Odyssey system ...
-
No products found
because this supplier's products are not listed.
A. Santana-Sánchez, et al.,
bioRxiv - Plant Biology 2021
Quote:
... Protein-specific antibodies raised against Flv3A (Agrisera), PsaB (AS10 695 ...
-
No products found
because this supplier's products are not listed.
Conrad En-Zuo Chan, et al.,
bioRxiv - Microbiology 2022
Quote:
The rabbit polyclonal antibody to S protein (polyS) (Sino Biological, Singapore) and anti-N (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Minyue Qiu, et al.,
bioRxiv - Immunology 2022
Quote:
... All monoclonal antibodies and recombinant mouse CD274 protein were purchased from R&D Systems (USA).
-
No products found
because this supplier's products are not listed.
Bridget M Curran, et al.,
bioRxiv - Neuroscience 2024
Quote:
... rabbit anti Red Fluorescent Protein (RFP) polyclonal antibodies (Rockland Antibodies, 200-101-379, 1:1000). For NF staining ...
-
No products found
because this supplier's products are not listed.
Leslie Duplaquet, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... PCR reaction was performed on the new synthetized vector to amplify the HA1-DCK*-P2A-GFP-HA2 sequence corresponding to the HDR (homology directed repair) DNA template and was purified using the NucleoSpin PCR Clean-up kit (Macherey-Nagel # 740609.10) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Gang Wang, et al.,
bioRxiv - Microbiology 2021
Quote:
... and β-actin protein primary antibody (ABclonal, Lot#9100026001) respectively ...
-
No products found
because this supplier's products are not listed.
Gaurav V. Sarode, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Coupled antibody-Dynabeads were prepared by adding Dynabeads protein A/G and 2 μg antibody [H3K9ac (Active Motif) or H3K27ac (Abcam)] to 100 μl ice-cold dilution buffer and rotating the tubes end-over-end at 4°C for 1 hour ...
-
No products found
because this supplier's products are not listed.
Gustavo A. Gomez, et al.,
bioRxiv - Genetics 2022
Quote:
... Protein expression was detected by species-specific secondary antibodies (VECTOR labs, DI-3088, and DI-1794), followed by DAPI (D1306 ...
-
No products found
because this supplier's products are not listed.
Ksenija Nesic, et al.,
bioRxiv - Cancer Biology 2020
Quote:
Cells stained for DNA repair foci on CellCarrier-96 Ultra Microplates (PerkinElmer, Cat# 6055302) were imaged on the Opera Phenix™ High Content Screening System (PerkinElmer) ...
-
No products found
because this supplier's products are not listed.
Tom Rankenberg, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Protein-DNA complexes were immunoprecipitated using anti-HA antibodies (Miltenyi Biotec) (Kaufmann et al. ...
-
No products found
because this supplier's products are not listed.
Katharina Kases, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... antibodies in Protein LoBind tubes (Eppendorf). Thereafter ...
-
No products found
because this supplier's products are not listed.
Dorota Raj, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Proteins were detected using anti-GFP antibody (3H9, Chromotek) or anti-alpha tubulin (T5168 ...
-
No products found
because this supplier's products are not listed.
Silvio Schmidt, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Primary antibodies against the activity-regulated cytoskeleton-associated protein (ARC; guinea pig, Synaptic system), the glial fibrillary acidic protein (GFAP ...
-
No products found
because this supplier's products are not listed.
Michael Fitzgerald, et al.,
bioRxiv - Genetics 2020
Quote:
Plasmid DNA containing the repair template with three tandem attP sites was co-transfected (1:1, Jetprime VWR#89129) with a plasmid containing Rosa26-Cas9/gRNA into mouse ES cells when confluency reached 70% ...
-
No products found
because this supplier's products are not listed.
James T. Van Leuven, et al.,
bioRxiv - Microbiology 2021
Quote:
... Antibodies specific for PR8 hemagglutinin protein (NR-3148, BEI Resources) and Ly6G (1A8, Bio X Cell) were detected with immPACT vector red and immPACT DAB ...
-
No products found
because this supplier's products are not listed.
Xinyi Zhang, et al.,
bioRxiv - Cell Biology 2024
Quote:
... but with different rabbit polyclonal antibodies from the Human Protein Atlas (HPA) purchased from Atlas Antibodies. On the next day ...
-
No products found
because this supplier's products are not listed.
Wonkyung Oh, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... was coated with hPD-L1-His protein and anti-PD-L1 antibody and anti-mouse IgG specific HRP conjugated secondary antibodies (SouthernBiotech, Birmingham, AL, USA) were added ...
-
No products found
because this supplier's products are not listed.
Ryo Yoshimura, et al.,
bioRxiv - Plant Biology 2023
Quote:
... DNA extracted DNA was fragmented by sonication (S220 from Covaris) and then converted to libraries using TruSeq DNA Sample Prep Kits (Illumina ...
-
No products found
because this supplier's products are not listed.
Clara Morral, et al.,
bioRxiv - Cell Biology 2023
Quote:
... slides were incubated with antibodies to p53 protein (CM5) (Leica Biosystems), EpCAM (CD326 ...
-
No products found
because this supplier's products are not listed.
Yanchun Zhang, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Proteins were detected with horseradish peroxidase (HRP)-conjugated secondary antibodies (Jackson Laboratory) and ECL (Pierce).
-
No products found
because this supplier's products are not listed.
Lydia J. Baker, et al.,
bioRxiv - Microbiology 2021
Quote:
... DNA was extracted using EZNA Tissue DNA Kit (Omega Bio-Tek) and the quality of the extraction was evaluated using the dsDNA HS assay using a Qubit 3.0 Fluorometer ...