-
No products found
because this supplier's products are not listed.
Cecilia Patitucci, et al.,
bioRxiv - Physiology 2023
Quote:
... genomic DNA was isolated from mouse tail snip using lysis buffer Tris-HCl (EuroMedex, 26-128-3094-B) pH8.5 100mM ...
-
No products found
because this supplier's products are not listed.
Amelia Foss, et al.,
bioRxiv - Biophysics 2020
Quote:
... and 2% amphotericin B (Euroclone) and maintained under hypoxic conditions (1% O2 ...
-
Cat# HY-120528,
inquire
Ask
Kruno Vukušić, Iva M. Tolić,
bioRxiv - Cell Biology 2023
Quote:
... Aurora B inhibitor ZM-447439 (MedChemExpress, IC50 value 130 nM ...
-
No products found
because this supplier's products are not listed.
Lisa Dettinger, et al.,
bioRxiv - Microbiology 2021
Quote:
... Complete rabies virus nucleoprotein and glycoprotein gene sequences were generated from rabies virus RNA extracted using Direct-zol RNA MiniPrep kit (R2052 Zymo, Irvine, CA, USA). Complete nucleoprotein and glycoprotein genes were amplified using Takara long amplicon Taq polymerase with GC buffers (RR02AG Takara Bio USA ...
-
No products found
because this supplier's products are not listed.
Federico Miozzo, et al.,
bioRxiv - Neuroscience 2021
Quote:
... mouse anti-TH (Immunostar 22941) 1:300 ...
-
No products found
because this supplier's products are not listed.
Momei Zhou, et al.,
bioRxiv - Microbiology 2023
Quote:
... The supernatant was immunoprecipitated (IP) with mouse anti-VZV gB mAb (SG2-2E6, Meridian Life Sciences) that was crosslinked to protein A beads (Pierce ...
-
No products found
Nithya Gajendran, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Lentivirus particles expressing human α-syn under cytomegalovirus (CMV) promoter (Applied Biological Materials, Inc, Canada) was used to re-express α-syn in SK-MEL-28 KO cells as described previously30 ...
-
No products found
because this supplier's products are not listed.
Evangelos Stefanidis, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Binding of T cell-secreted A4-Fc on OT-I CD47 was assessed by staining with labeled goat anti-mouse IgG Fc (polyclonal, antibodies-online) at 4°C for 30min ...
-
No products found
because this supplier's products are not listed.
Nikhil J. Parekh, et al.,
bioRxiv - Immunology 2019
Quote:
... Live cells were incubated in Fc block and 10% normal mouse serum (Gemini Bio-Products) at 4°C ...
-
No products found
because this supplier's products are not listed.
Emily Maguire, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Designated wells were inhibited by pre exposure for 2 hours with 3-a-aminocholestane (20µM, B-0341), LY294002 (10µM, B-0294) or SF1670 (5µM, B-0350) (Echelon Bioscience). Cells were then exposed to ice cold 0.5 M TCA (Trichloroacetic acid T6399 Sigma ...
-
No products found
because this supplier's products are not listed.
Di Hu, et al.,
bioRxiv - Genomics 2023
Quote:
... or pA-Tn5 Transposase - loaded (Diagenode C01070001; Lot 1/b/b).
-
No products found
because this supplier's products are not listed.
Mukundan Attur, et al.,
bioRxiv - Cell Biology 2019
Quote:
... supplemented with 10% FCS (Atlanta Biologicals). Cells at 50-70% confluency were transfected by overnight incubation with the indicated cDNAs in complete growth medium using TransIT®-LT1 - Transfection Reagent according to the manufacturer’s instructions (Mirus Bio ...
-
No products found
because this supplier's products are not listed.
Jia Gu, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Antibody to nuclear factor kappa B p65 (anti-NF-κB, PB0073) and rabbit or mouse secondary antibodies were purchased from Boster Bio ...
-
No products found
because this supplier's products are not listed.
Anna Onnis, et al.,
bioRxiv - Immunology 2022
Quote:
... B (SEB; Toxin Technologies, #BT202) and E (SEE ...
-
No products found
because this supplier's products are not listed.
Celia Segui-Perez, et al.,
bioRxiv - Cell Biology 2022
Quote:
... b-actin (Bioss, bs-0061R), MUC13 (Abcam ...
-
No products found
because this supplier's products are not listed.
Andrea Di Francesco, et al.,
bioRxiv - Genetics 2023
Quote:
... Antibodies including Fc block (clone 2.42, Leinco Technologies) were added and incubated for 30 minutes at 4°C ...
-
No products found
because this supplier's products are not listed.
Siu-Shing Wong, et al.,
bioRxiv - Cell Biology 2024
Quote:
... high glass bottom μ-dishes (ibidi; for FCS experiments), and desiccated for 1 min at 25°C before covering with Voltalef oil (H10S PCTFE ...
-
No products found
because this supplier's products are not listed.
Yixuan Huang, et al.,
bioRxiv - Microbiology 2023
Quote:
... LAMBDA 10-B Smart Shutter from Sutter Instrument, an OkoLab stage incubator ...
-
No products found
because this supplier's products are not listed.
Yizhi Yuan, et al.,
bioRxiv - Biochemistry 2022
Quote:
... supplemented with 10% (v/v) FCS on 6 cm cell culture dishes (Sarstedt). After 48 h ...
-
No products found
because this supplier's products are not listed.
Mark S. Ladinsky, et al.,
bioRxiv - Cell Biology 2020
Quote:
... placed individually into brass planchettes (Type A/B; Ted Pella, Inc.), and rapidly frozen with a HPM-010 High Pressure Freezing machine (BalTec/ABRA) ...
-
No products found
because this supplier's products are not listed.
Chien-Wei Wang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... or anti-CA125 epitope group B (Fitzgerald, M11-like, M61703, 1:2000). The membrane was washed and hybridized with goat anti-mouse secondary antibody conjugated with horseradish peroxidase (HRP ...
-
No products found
because this supplier's products are not listed.
C. Cansell, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Primary anti-rabbit antibodies were against Iba1 (1:500, CP290A, B, Biocare Medical, USA) and GFAP (1:300 ...
-
No products found
because this supplier's products are not listed.
Lyudmila Shalamova, et al.,
bioRxiv - Microbiology 2022
Quote:
... 500 or 1000 U/ml pan-species IFN-alpha (B/D) (PBL Assay Science) and infected at an MOI of 0.01 ...
-
No products found
because this supplier's products are not listed.
Quynh T. Phan, et al.,
bioRxiv - Microbiology 2021
Quote:
... mouse liver endothelial cells (Cell Biologics), and hTert-immortalized human microvascular endothelial cells (American Type Culture Collection ...
-
No products found
because this supplier's products are not listed.
Sebastian Jusuf, et al.,
bioRxiv - Microbiology 2020
Quote:
... GBS (ATCC 12386) was grown in New Granada Media/Strep B Carrot Broth (Z40, Hardy Diagnostics) at 37°C for 48 to 72 hours until the broth turned a rich orange-red color ...
-
No products found
because this supplier's products are not listed.
Matthew L. Goodwin, et al.,
bioRxiv - Immunology 2020
Quote:
... Secreted postfusion gB trimers were purified using Strep-Tactin resin (IBA Life Sciences) before being run over a Superose 6 size-exclusion column (GE Healthcare ...
-
No products found
because this supplier's products are not listed.
Jerry Yan, et al.,
bioRxiv - Bioengineering 2023
Quote:
... plated at 800,000 splenocytes/well and restimulated with 10 μg rabies virus glycoprotein peptide (AnaSpec) for 24h at 37 °C ...
-
No products found
because this supplier's products are not listed.
Mahlon Collins, Yang Li, Robert Bowser,
bioRxiv - Neuroscience 2019
Quote:
... mouse monoclonal anti-scaffold attachment factor B (SAFB, Lifespan Biosciences, Seattle, WA, USA, 1:100), mouse monoclonal anti-SAFB (Proteintech ...
-
No products found
because this supplier's products are not listed.
Joaquín Miguel Pellegrini, et al.,
bioRxiv - Immunology 2020
Quote:
... Cells were then incubated with mouse anti-human LC3A/B antibody (MBL International, M152-3) for 20 min ...
-
No products found
because this supplier's products are not listed.
Mirren Charnley, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Fc-DL4 (86 nM; BioVision, P1163), Fc-VCAM-1 (19 nM ...
-
No products found
because this supplier's products are not listed.
Neha Upadhyay-Tiwari, et al.,
bioRxiv - Plant Biology 2024
Quote:
... with an autosampler (GILSON FC 203B). Buffer B was 200 mM ammonium formate with 90% (v/v ...
-
No products found
because this supplier's products are not listed.
Francine Bittencourt Schiffler, et al.,
bioRxiv - Microbiology 2023
Quote:
... Nucleic acid extraction from blood samples was performed using the MasterPure™ Complete DNA and RNA Purification Kit (Lucigen, LGC Ltd, Teddington, GB). For metagenomic analysis ...
-
No products found
because this supplier's products are not listed.
Kamyab Javanmardi, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The plasmid expressing the VSV-G (vesicular stomatitis virus glycoprotein) was purchased from Cell Biolabs (pCMV-VSV-G, Part No. RV-110). The lentiviral plasmid used to generate the HEK-293T stable cell lines expressing the human ACE2 gene (GenBank ID NM_021804 ...
-
No products found
because this supplier's products are not listed.
Yuyi Wang, et al.,
bioRxiv - Cancer Biology 2020
Quote:
HUVEC (Lifeline Cell Technology, Frederick MD; FC-0003), HDMEC (Clonetics ...
-
No products found
because this supplier's products are not listed.
Philippe C Després, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... Cytosine and 5-FC were purchased from Alfa Aesar (now Thermo Scientific Chemicals ...
-
No products found
because this supplier's products are not listed.
Xavier Leray, et al.,
bioRxiv - Biophysics 2021
Quote:
... Magic red Cathepsin-B essay (ImmunoChemistry Technologies).
-
No products found
because this supplier's products are not listed.
Ling Xu, et al.,
bioRxiv - Cell Biology 2024
Quote:
... These sample series were transferred to a plate pre-coated with the spike glycoprotein S1-RBD from SARS-CoV-2 (Elabscience, China, E-EL-E605). After 2 h of incubation ...
-
No products found
because this supplier's products are not listed.
Samuel S.H. Weng, et al.,
bioRxiv - Biochemistry 2019
Quote:
... and plasma and bone marrow interstitial fluid samples from three pediatric B-ALL patients (B-ALL-1, −2, −3) were processed on an epMotion M5073 automated liquid handling system (Eppendorf) controlled by an EasyCon tablet (Eppendorf) ...
-
No products found
because this supplier's products are not listed.
Bing Han, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
No products found
because this supplier's products are not listed.
Xufeng Xie, et al.,
bioRxiv - Microbiology 2024
Quote:
... Group 2: Polymyxin B (PMB) (1 mg/kg, i.p., Solarbio, China); Group 3 ...
-
No products found
because this supplier's products are not listed.
Siyu Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... mouse hut (Braintree Scientific), nestlets and hydrogel (Bio-Serv).
-
No products found
because this supplier's products are not listed.
Jingnan Liu, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... mouse anti-mCherry (1:1000, Abbkine Scientific Co. ...
-
No products found
because this supplier's products are not listed.
María A. Duque-Correa, et al.,
bioRxiv - Immunology 2020
Quote:
... 10% R-spondin1 conditioned medium (293T-HA-Rspo1-Fc cell line, Trevigen), 1mM N-acetylcysteine (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Hazel Stewart, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Pacific Blue-conjugated anti-CD71 (Exbio, MEM-75, FC 1 μg / 100 μl / 106 cells), StrepMAB-Classic (IBA LifeSciences ...
-
No products found
because this supplier's products are not listed.
Rohin Banerji, et al.,
bioRxiv - Bioengineering 2023
Quote:
Isolated mouse lungs were ventilated (Kent Physiosuite Mouse ventilator, Kent Scientific) through a tracheal cannula and perfused through two cannulas inserted into the pulmonary artery (PA ...
-
No products found
because this supplier's products are not listed.
Cristina Marí-Carmona, et al.,
bioRxiv - Plant Biology 2021
Quote:
... and anti-mouse (Agrisera) were used as secondary antibodies at 1/20,000 and 1/10,000 dilutions ...
-
No products found
because this supplier's products are not listed.
Serena Omo-Lamai, et al.,
bioRxiv - Bioengineering 2023
Quote:
... mouse fibrinogen (Innovative Research) was incubated with NHS ester Alexa Fluor 488 (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
E.A. Rosado-Olivieri, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... mouse J2 dsRNA (SCICONS; 1;1,000), phospho Histone H3 (Cell Signaling ...
-
No products found
because this supplier's products are not listed.
Yang Liu, et al.,
bioRxiv - Genomics 2020
Quote:
FFPE samples of adult mouse and mouse embryo were obtained from Zyagen (San Diego, CA). According to Zyagen protocol ...
-
No products found
because this supplier's products are not listed.
Edmundo G. Vides, et al.,
bioRxiv - Biochemistry 2022
Quote:
... mouse anti-Rab10 (1:1000, Nanotools); and rabbit anti-phospho Rab10 (1:1000 ...