-
No products found
because this supplier's products are not listed.
Jorge Morales, et al.,
bioRxiv - Microbiology 2021
Quote:
... incubated with a 1:1,000 dilution of mouse anti-GFP [B-2] (SantaCruz Biotechnology) or a rat anti-RFP [5F8] (Chromotek) followed by a 1:5,000 dilution of the horseradish peroxidase-conjugated secondary antibody against mouse IgG (7076 ...
-
No products found
because this supplier's products are not listed.
Joseph C. Maggiore, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Media for both dissociated cells and explants consisted of neurobasal medium + 2% B-27 + 400-500 μm L-glutamine + 1% fetal bovine serum (Atlanta Biologicals) + 2.0-2.5 mg/mL glucose + 10-20 ng/mL 2.5S nerve growth factor ...
-
No products found
because this supplier's products are not listed.
Michal Schwartz, et al.,
bioRxiv - Microbiology 2022
Quote:
... using FAM labeled HCMV primer and probe: Human CMV HHV5 kit for qPCR using a glycoprotein B target (PrimerDesign); and HEX labeled RPP30 copy number assay for ddPCR (Bio-Rad) ...
-
No products found
because this supplier's products are not listed.
Sahar Keshvari, et al.,
bioRxiv - Developmental Biology 2021
Quote:
TUNEL staining was performed using TACS® 2 TdT DAB (diaminobenzidine) Kit (Trevigen, Gaithersburg, Maryland, USA) according to manufacturer instruction.
-
No products found
because this supplier's products are not listed.
Aikaterini Kalamari, et al.,
bioRxiv - Animal Behavior and Cognition 2020
Quote:
... except for 7 pairs of males from pilot experiment B that originated directly from Charles River. Only male rats were included in the experiments ...
-
No products found
because this supplier's products are not listed.
Simona Pellecchia, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... if putative bc14 and bc30 were in the whitelist provided by Cellecta, the lineage barcode represented by the string “bc14:bc30” was assigned to the corresponding cell retrieved from read one ...
-
No products found
because this supplier's products are not listed.
NV DiBenedetto, et al.,
bioRxiv - Microbiology 2023
Quote:
... The same procedure is used for the Toxin B ELISA but N4A8 monoclonal antibodies (BBI solution) diluted at 4ng/ml in PBS was used for the capture antibodies and the T4G1 monoclonal antibodies previously coupled to biotin were used as detection antibodies (BBI solution ...
-
No products found
because this supplier's products are not listed.
Renata Varnaitė, et al.,
bioRxiv - Immunology 2020
Quote:
... SARS-CoV-2 specific IgM antibodies were detected using EDI Novel Coronavirus COVID-19 IgM ELISA kit (Epitope Diagnostics), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Biying Sun, et al.,
bioRxiv - Plant Biology 2024
Quote:
Pladienolide B (CAS:445493-23-2) was purchased from Adooq. PB ...
-
No products found
because this supplier's products are not listed.
Estrela Neto, et al.,
bioRxiv - Cell Biology 2020
Quote:
... a multi-neurotrophin rapid screening ELISA kit (#BEK-2231, Tebu-bio, France) was used according to the manufacturers’ protocol ...
-
No products found
because this supplier's products are not listed.
Jeong Min Lee, et al.,
bioRxiv - Biochemistry 2024
Quote:
... FMS-like Tyrosine Kinase 3 Ligand (Flt3L, 100 ng/ml) (CellGenix, 1415-050) and Thrombopoietin (TPO ...
-
No products found
because this supplier's products are not listed.
Tania J. Lebratti, et al.,
bioRxiv - Immunology 2020
Quote:
... IL-18 was measured using the mouse IL-18 ELISA kit (MBL International) according to manufacturer’s instructions at half-volumes.
-
No products found
because this supplier's products are not listed.
Jun Li, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and p-SCN-Bn-TCMC (S-2-(4-Isothiocyanatobenzyl)-1,4,7,10-tetraaza-1,4,7,10-tetra(2-carbamoylmethyl)cyclododecane) (catalog No. B-1005) were purchased from Macrocyclics, Inc ...
-
TACC3 inhibitor
Sold for research purposes only.
Cat# 2474.0, SKU# 2474-5 mg,
5mg, US $137.50 / EA, EURO, €125 / EA
Ask
Durga Praveen Meka, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Spindlactone B (SPL-B; a TACC3 inhibitor; Axon Medchem) – 0.25 µg per ml was added at the time of plating (at 0h) ...
-
No products found
because this supplier's products are not listed.
Pedro Aguilar-Garrido, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... the cells were selected by blasticidin (2 μg/mL) (AG Scientific, CA, USA, Cat# B-1247) and hygromycin (400 μg/mL ...
-
No products found
because this supplier's products are not listed.
Alexandre Guet-McCreight, et al.,
bioRxiv - Neuroscience 2022
Quote:
... We also used intracellular recordings of human putative L5 parvalbumin (PV, neuron ID: 528687520) interneurons available from ABI (Gouwens et al., 2018). We used reconstructed human neuron morphologies from ABI for the L5 Pyr neuron (Neuron ID ...
-
No products found
because this supplier's products are not listed.
Carina C D Joe, et al.,
bioRxiv - Bioengineering 2021
Quote:
Residual host-cell protein (HCP) was quantified using the HEK293 HCP ELISA kit (Cygnus Technologies) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Romain Durand, et al.,
bioRxiv - Genomics 2023
Quote:
... hygromycin B (BioShop Canada), G418 (BioShop Canada) ...
-
No products found
because this supplier's products are not listed.
Andrew J. Stout, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 10ng/mL insulin-like growth factor 1 (IGF-1; Shenandoah Biotechnology #100-34AF-100UG, Warminster, PA, USA) and 10 ng/mL epidermal growth factor (EGF ...
-
No products found
because this supplier's products are not listed.
Luis Vigetti, et al.,
bioRxiv - Cell Biology 2024
Quote:
... biotinylated ligands (b-X): b-PEG-OH (PEG1207.0100, Iris Biotech, 4847 g/mol), b-PEG-NH2 (PEG1046 ...
-
No products found
because this supplier's products are not listed.
Aileen A. Nava, et al.,
bioRxiv - Genetics 2023
Quote:
... The macros’ algorithm then performs the same tasks as commercially available quantification software like Image Studio Lite from LI-COR Biosciences 174 ...
-
No products found
because this supplier's products are not listed.
Mei Zhang, et al.,
bioRxiv - Neuroscience 2019
Quote:
Freshly dissected mouse brains were incubated in Golgi solution A and B (FD Rapid GolgiStain Kit, FD NeuroTechnologies) for 10 days ...
-
No products found
because this supplier's products are not listed.
Vilma Väänänen, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... Equal amounts of solutions A (Enhancer) and B (Activator) of the kit (GoldEnhance for LM, 2112-28ML, Nanoprobes) were mixed and left to incubate for 10 minutes before addition of solutions C (Initiator) ...
-
No products found
because this supplier's products are not listed.
Shijie Cao, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Azide-labelled pHPMA-b-pBMA or pMAA-b-pBMA polymer was reacted with AFDye647-DBCO (Click Chemistry Tools) and then formulated into micelles ...
-
No products found
because this supplier's products are not listed.
Yi-Pin Lin, et al.,
bioRxiv - Microbiology 2020
Quote:
... the ELISA kits to determine the levels of IFNγ and TNFα from house mouse (Mus muscuslus) (Tonbo Bioscience, San Diego, CA) were utilized to detect those cytokines in white-footed mice ...
-
No products found
because this supplier's products are not listed.
Edd Ricker, et al.,
bioRxiv - Immunology 2021
Quote:
... B cell cultures were harvested at d2 and chromatin extracts were prepared using the truChIP Chromatin Shearing Reagent Kit (Covaris). 100μg of sonicated DNA protein complexes were used for immunoprecipitations with anti-IRF5 (Abcam #ab21689) ...
-
Phospholipase D Assay Kit
Cat# EPPD-100,
1.0 kit, 100 tests, USD $299.0
Ask
Yehezqel Elyahu, et al.,
bioRxiv - Immunology 2024
Quote:
... The levels of AST and ALT in murine serum were measured using EnzyChrom™ ELISA kits for AST and ALT (BioAssay Systems) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Sabina Kanton, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Two constrained B-splines regression models (FHC, FHM) were then fitted (implemented in the R package cobs) ...
-
No products found
because this supplier's products are not listed.
Dessislava Malinova, et al.,
bioRxiv - Immunology 2020
Quote:
... B cells were incubated with microbeads (Bangs laboratories) conjugated to anti-Igκ and Ea-peptide (Biotin-GSGFAKFASFEAQGALANIAVDKA-COOH ...
-
No products found
because this supplier's products are not listed.
Julio David Vega-Torres, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 5-gm% fat, product #F7463) and Western-like high-saturated fat diet (WD, 20-gm% fat, product #F7462) were obtained from Bio-Serv (Frenchtown, NJ, USA). The macronutrient composition and fatty acid profiles are detailed in a previous study and summarized in Supplemental Table 1 (Vega-Torres et al. ...
-
PhotoDextran® is 1 gram of lyophilized methacrylated dextran. PhotoDextran® provides 3D...
Cat# 5333-1KIT,
1 gram, USD $325.0
Ask
Evelien Eenjes, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 10 μg/mL PureCol (Advanced Biomatrix; 5005-B) for 2 hrs at 37°C ...
-
No products found
because this supplier's products are not listed.
Bing Han, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
No products found
because this supplier's products are not listed.
Rebecca A Capel, et al.,
bioRxiv - Physiology 2019
Quote:
Male Dunkin Hartley guinea pigs (350-550g, Envigo or B&K Universal) were housed and maintained in a 12 h light-dark cycle with ad libitum access to standard diet and sterilised water ...
-
No products found
because this supplier's products are not listed.
Yijia Liow, et al.,
bioRxiv - Microbiology 2023
Quote:
... and (b) control diet (D21052808, Research Diets, Inc., New Brunswick, NJ, USA), as shown in Fig 1 ...
-
No products found
because this supplier's products are not listed.
Faryal Ijaz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... genomic DNA was isolated using Favor Prep Blood Genomic DNA Extraction Mini Kit (FABGK001-2, Favorgen Biotech Corp) and used for screening of mutant clones by DST-PCR.
-
No products found
because this supplier's products are not listed.
Lisa M. Røst, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 1,213C,2- or U13C6-glucose (2 g/l, 99%, Cambridge Isotope Laboratories) and incubated over night before treatment ...
-
No products found
because this supplier's products are not listed.
Kevin Menden, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Small RNAseq libraries from frozen tissue were prepared starting from 2 micrograms of total RNA using the Nextflex Small RNA-seq kit v3 (Bioo Scientific) and the NEBNext Small RNA library prep set for Illumina (New England Biolabs) ...
-
No products found
because this supplier's products are not listed.
Vanessa Nunes, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5]-PEG(2) (SuSoS) in 10 mM HEPES at pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Du-Hwa Lee, et al.,
bioRxiv - Plant Biology 2022
Quote:
... anti-GAPC1/2 (Agrisera, AS15 2894 ...
-
No products found
because this supplier's products are not listed.
André Folgado, Rita Abranches,
bioRxiv - Plant Biology 2021
Quote:
Cardosin B coding sequence (EMBL no. AJ237674) without the native signal peptide was synthesized by NZYTech (NZYTech, Portugal) with the addition of NcoI and SalI restriction sites at the 5’and 3’ends respectively ...
-
No products found
because this supplier's products are not listed.
Caro-Astorga Joaquin, et al.,
bioRxiv - Microbiology 2019
Quote:
... reduced with 2 μL of 50 mM Tris(2-carboxyethyl) phosphine (TCEP, SCIEX), pH 8.0 ...
-
No products found
because this supplier's products are not listed.
Timothy S. Balmer, Laurence O. Trussell,
bioRxiv - Neuroscience 2019
Quote:
... fluorescent microspheres (Spherotech, FP4060-2) were imaged following the same procedures used for biocytin filled cells (Figure S5).
-
No products found
because this supplier's products are not listed.
Niyati Jhaveri, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Slides were then rinsed through two rounds of incubation in distilled water for 2 minutes and stored in Hydration Buffer from the PhenoCycler Staining Kit (Akoya Biosciences, MA, #7000008) until ready for staining.
-
No products found
because this supplier's products are not listed.
Sherine E. Thomas, et al.,
bioRxiv - Biochemistry 2019
Quote:
... 1–2 M Ammonium sulfate or in sparse matrix screens: Wizard 1&2 (Molecular Dimensions), Wizard 3&4 (Molecular Dimensions) ...
-
No products found
because this supplier's products are not listed.
Qian Shi, et al.,
bioRxiv - Physiology 2022
Quote:
Excised hearts were loaded with Rhod-2 AM (rhodamine 2 acetoxymethyl ester; 5μM, AAT Bioquest) in Krebs–Henseleit (KH ...
-
No products found
because this supplier's products are not listed.
Fernando Y. Maeda, et al.,
bioRxiv - Cell Biology 2021
Quote:
... mouse splenic B-cells or a B-cell line (A20) were incubated for 30 min at 4°C in 35 mm glass-bottom dishes (MatTek) coated with poly-lysine and then with protein-coated beads at a cell:bead ratio of 1:2 for another 30 min at 4°C ...
-
No products found
because this supplier's products are not listed.
Tiesuo Zhao, et al.,
bioRxiv - Immunology 2024
Quote:
The tissue samples were incubated with primary antibodies (CD3, 1:100, OmnimAbs; CD4, 1:200, CST; CD8, 1:800, CST; Granzyme B, 1:200, Bioworld; CD86 ...
-
No products found
because this supplier's products are not listed.
Omobukola Solebo, et al.,
bioRxiv - Microbiology 2021
Quote:
... 2% peptone (20-260, Genesee Scientific), and 4% dextrose ...
-
No products found
because this supplier's products are not listed.
Vanessa R Povolo, et al.,
bioRxiv - Microbiology 2022
Quote:
... and xylan (2% w/v, Megazyme) were prepared with nanopure water and filter sterilized using 0.4 μm surfactant-free cellulose acetate filters (Corning) ...
-
No products found
because this supplier's products are not listed.
María del Carmen Muñoz-Marín, et al.,
bioRxiv - Microbiology 2021
Quote:
... The tubes were agitated for 2 min with a Vortex-Genie 2 bead beater (Scientific Industries, Inc), and incubated for 1 h at 55°C with 20 mg ml−1 proteinase K (Qiagen) ...