-
Cat# HY-B1618-50 mg,
50 mg, USD $60.0
Ask
Di Wan, Tongchuang Lu, Chenyang Li, Changlong Hu,
bioRxiv - Neuroscience 2023
Quote:
... Corticosterone (#HY-B1618) was purchased from MedChemExpress (NJ, USA). All drugs were dissolved in DMSO with a final concentration not exceeding 0.1%.
-
No products found
because this supplier's products are not listed.
Lovorka Stojic, et al.,
bioRxiv - Cell Biology 2019
Quote:
... microTUBE-15 beads strips (520159, Covaris) were used in a total volume of 15 µl ...
-
No products found
because this supplier's products are not listed.
Dirk Metzler, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... we assume that these bins represent 5-km-wide strips that are parallel to the initial contact line (ICL) of the two color morphs ...
-
No products found
because this supplier's products are not listed.
Tom Biton, et al.,
bioRxiv - Cell Biology 2023
Quote:
... The block edges were covered with additional strips of carbon tape and 2-4 strips of copper tape (EMS; cat#77802) and coated with a layer of colloidal silver liquid (EMS ...
-
No products found
because this supplier's products are not listed.
Brandon J. DeOre, et al.,
bioRxiv - Cell Biology 2020
Quote:
Commercial ELISA kits were purchased from Cytoskeleton (G-LISA) to quantify RhoA and Rac1 activation (Cytoskeleton) ...
-
No products found
because this supplier's products are not listed.
Kouhei Yoshida, et al.,
bioRxiv - Bioengineering 2023
Quote:
The AAV Titration ELISA Kit series (PROGEN Biotechnik GmbH) was used to quantify AAV capsid titers depending on the AAV serotype ...
-
No products found
because this supplier's products are not listed.
Lisandra Vila Ellis, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... the strips were mounted on slides using Aquamount (18606, Polysciences) with the flat side facing the coverslip ...
-
No products found
because this supplier's products are not listed.
Hailong Guo, et al.,
bioRxiv - Microbiology 2023
Quote:
384 well ELISA plates were coated with 20µl of RBD (SARS-CoV-2 Omicron BA.1, ACROBiosystems) at 1µg/mL in PBS at 4°C overnight ...
-
No products found
because this supplier's products are not listed.
Darach Miller, Adam Dziulko, Sasha Levy,
bioRxiv - Systems Biology 2024
Quote:
Amino-acid additive stocks and selective plates with 5-FOA (GoldBio), hygromycin ...
-
No products found
because this supplier's products are not listed.
Chunsheng Zhou, et al.,
bioRxiv - Immunology 2020
Quote:
... and plate-bound α-CD3 (clone 145-TC11, 5 ug/ml; BioXCell) in complete RPMI medium supplemented with 10% fetal bovine serum ...
-
No products found
because this supplier's products are not listed.
Yunfeng Zhang, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... was a gift from Elisa Izaurralde (Addgene plasmid # 37370) (78) ...
-
No products found
because this supplier's products are not listed.
Byron Lee, Nima Jaberi-Lashkari, Eliezer Calo,
bioRxiv - Cell Biology 2022
Quote:
HeLa cells were cultured in 5% CO2 on cell culture-treated 10 cm plates (Genesee Scientific, 25-202) in Dulbecco’s Modified Eagle Medium (DMEM ...
-
No products found
because this supplier's products are not listed.
T.B. Wissing, et al.,
bioRxiv - Bioengineering 2021
Quote:
Rectangular Velcro strips of 5×15 mm each were attached to the flexible membranes of 6-well Bioflex culture plates (untreated, Flexcell Int, McKeesport, PA) (dynamic loading groups ...
-
No products found
because this supplier's products are not listed.
Callam T Davidson, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 3H4-Corticosterone (250nM) and NADP+ (2mM; Cambridge Bioscience) were added before incubation in a shaking water bath (37°C) ...
-
No products found
because this supplier's products are not listed.
Callam T Davidson, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 11-Dehydrocorticosterone and corticosterone were from Steraloids (Newport, USA). Tritiated steroids ([1,2,6,7]-3H4-corticosterone and [1,2,6,7]-3H4- cortisone ...
-
No products found
because this supplier's products are not listed.
Federica Lucantonio, et al.,
bioRxiv - Neuroscience 2023
Quote:
For implanting corticosterone pellets (#G-111, Innovative Research of America), mice were anaesthetized with ketamine (100 mg/kg ...
-
No products found
because this supplier's products are not listed.
Andres R. Henriquez, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
Plasma levels of epinephrine (adrenaline) and corticosterone were quantified using kits from Rocky Mountain Diagnostics (Colorado Springs, CO) and Arbor Assays (Ann Arbor ...
-
No products found
because this supplier's products are not listed.
Khushali Patel, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... ELISAs were performed using a β-hCG ELISA kit (EIA-1911; DRG International Springfield NJ) and IL-1β ELISA kit (DY401-05 ...
-
No products found
because this supplier's products are not listed.
Wei-Ping Hu, et al.,
bioRxiv - Molecular Biology 2023
Quote:
Human BMPR2 ELISA Kit (orb406355, Biorbyt, United Kingdom) was used to detect the level of soluble BMPR2 in serum ...
-
No products found
because this supplier's products are not listed.
Yifeng Wang, et al.,
bioRxiv - Immunology 2023
Quote:
... 96-well ELISA plates (42592, Costar) were coated with NP23-BSA (Biosearch Technologies) in PBS overnight and washed ...
-
No products found
because this supplier's products are not listed.
Taufik A. Valiante, Bojan Garic,
bioRxiv - Neuroscience 2021
Quote:
... Platinum-iridium grid and strip electrodes (PMT Corp MN, USA) were utilized with 10 mm inter-electrode distances ...
-
No products found
because this supplier's products are not listed.
Nikolaus Frischauf, et al.,
bioRxiv - Immunology 2024
Quote:
... In a regular 96 ELISA flat bottom plate 15% normal human serum (Sanquin, Amsterdam, The Netherlands) was added to the liposome mixture (R1 from the kit ...
-
No products found
because this supplier's products are not listed.
Emmet M. Power, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Serum corticosterone and tissue samples were taken from a mixture of C57/Bl6J (Jackson laboratory) and Crh-IRES-Cre mice (2-4 months) ...
-
No products found
because this supplier's products are not listed.
Yasuaki Yanagawa, et al.,
bioRxiv - Microbiology 2019
Quote:
... histolytica antibody was detected using a commercially available ELISA kit (Entamoeba histolytica IgG-ELISA; GenWay Biotech, Inc., San Diego, CA. USA). All procedures were performed according to the manufacturer’s instructions ...
-
Corticosterone (NSC-9705, 17-deoxycortisol, 11β,21-dihydroxyprogesterone), the major stress...
Cat# S4752, SKU# S4752-50mg,
50mg, $97.00
Ask
Vivek Jani, et al.,
bioRxiv - Biophysics 2023
Quote:
... muscle strips were exposed to 2 µM mavacamten (Selleck Chemicals, Houston, TX) and 5.95 mM dATP-containing solutions (Millipore Sigma ...
-
No products found
because this supplier's products are not listed.
Seung-Eon Roh, et al.,
bioRxiv - Neuroscience 2023
Quote:
... CSF Orexin A was detected using a competitive ELISA Kit (Phoenix Pharmaceuticals) (Liguori et al ...
-
No products found
because this supplier's products are not listed.
Abigail E. Powell, et al.,
bioRxiv - Immunology 2020
Quote:
... plates were washed 3X with PBST and blocked overnight at 4 °C with ChonBlock Blocking/Dilution ELISA Buffer (Chondrex). ChonBlock was removed manually and plates were washed 3X with PBST ...
-
Prepared to contain higher collagenase and caseinase activities. A dialyzed, lyophilized powder.
Cat# LS005282,
1 gm, $246.00
Ask
Gerald Sakamaki, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The dorsal horn strips were digested in a papain solution (45 μL papain, no. 3126; Worthington Biochemical ...
-
No products found
because this supplier's products are not listed.
Bo Xu, et al.,
bioRxiv - Plant Biology 2019
Quote:
... apart from the barley epidermal strips imaged using an Nikon Diaphot 200 Inverted Phase Contrast Microscope (Nikon). Stomatal aperture and density were analyzed using particle analysis (http://rsbweb.nih.gov/ij/).
-
No products found
because this supplier's products are not listed.
John Lees, et al.,
bioRxiv - Molecular Biology 2023
Quote:
MeDIP-Seq libraries for Ion Torrent semiconductor sequencing were performed on the Ion Torrent PGM using a modified protocol from Ion Plus Fragment Library kit (Catalog # 4471252) combined with a 5-hydroxymethylcytosine (5hmC Kit, Catalog # AF-110–0016) immunoprecipitation kit (Diagenode) according to a previously optimized protocol (Guerrero-Bosagna & Jensen ...
-
No products found
because this supplier's products are not listed.
Jirina Zackova Suchanova, et al.,
bioRxiv - Plant Biology 2023
Quote:
... then 5×106 cells were plated on ESAW agar plates containing 450 μg mL-1 nourseothricin (Jena Bioscience), and incubated in constant light at 18 °C.
-
No products found
because this supplier's products are not listed.
Michael Ronzetti, et al.,
bioRxiv - Biochemistry 2022
Quote:
The DSF assay plate was constructed by dry-spotting 5 nL of SYPRO Orange with an acoustic dispenser (Echo 555, Labcyte) into a 384-well PCR plate ...
-
No products found
because this supplier's products are not listed.
Julian R. Smith, et al.,
bioRxiv - Immunology 2022
Quote:
H1 control AC16 cardiomyocytes and cGAS KO AC16s were seeded in 12-well plates and transfected with 5 mg of CT-DNA using Transit X2 (Mirus) at a 2:1 ratio for 8 h prior to harvest ...
-
No products found
because this supplier's products are not listed.
Clara Schmidt, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... are seeded in a 24-well plate (TPP, #92024) at 30-40k cells per well in E8 + ROCKi (5 µM Y-27632, Tocris #1254). All differentiation media are based on CDM that consists of 5 mg/ml bovine serum albumin (Europa Biosciences ...
-
No products found
because this supplier's products are not listed.
Randy Yoo, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 96-well plate low volume crystallization plates (Hampton Research) were all set up at room temperature using sitting drop method with ratios 1:1 and 1:2 for precipitant to protein ...
-
No products found
because this supplier's products are not listed.
Gregor Diensthuber, et al.,
bioRxiv - Genomics 2023
Quote:
... using 5-Methyluridine-5’-Triphosphate (5-mUTP, Trilink, N-1024-1) instead of UTP ...
-
No products found
because this supplier's products are not listed.
Daniel Wells, et al.,
bioRxiv - Genetics 2019
Quote:
... and the resulting immune antisera were tested against the recombinant antigen by ELISA (Eurogentec), and the endogenous protein in mouse testes from WT and KO mice (data not shown) ...
-
No products found
because this supplier's products are not listed.
Andrea Rizzotto, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... and 5 μL of 5 μg/mL Propidium Iodide (Biotium) for cell death detection ...
-
No products found
because this supplier's products are not listed.
Johnathan Abou-Fadel, et al.,
bioRxiv - Systems Biology 2019
Quote:
... 5 µm (Phenomenex) column ...
-
No products found
because this supplier's products are not listed.
Régis E Meyer, et al.,
bioRxiv - Cell Biology 2020
Quote:
... or 1-NMPP1 (5 μM, Calbiochem; 5 mM stock in dimethylsulfoxide) were added to the medium at the time of prophase exit ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Josefa Cruz, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... ELISA was performed according to the manufacturer’s instructions using a commercial ELISA kit (Bertin Bioreagents) that detects ecdysone and 20- hydroxyecdysone with the same affinity ...
-
No products found
because this supplier's products are not listed.
Bikul Das, et al.,
bioRxiv - Immunology 2020
Quote:
... ELISA plates were thoroughly washed 2 times each using 1× PBS+0.05% Tween 20 (AMRESCO, USA) and 1× PBS ...
-
No products found
because this supplier's products are not listed.
RE Akhigbe, A.F Ajayi,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
ELISA kits used for the analysis of reproductive hormones were from Monobind Inc. ...
-
No products found
because this supplier's products are not listed.
Bo Xu, et al.,
bioRxiv - Plant Biology 2019
Quote:
... Epidermal strips for both aperture and density measurement were imaged using an Axiophot Pol Photomicroscope (Carl Zeiss) apart from the barley epidermal strips imaged using an Nikon Diaphot 200 Inverted Phase Contrast Microscope (Nikon) ...
-
No products found
because this supplier's products are not listed.
Yaping Meng, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... TSA Plus Cyanine 5 Kit (Akoya Biosciences, NEL745001KT) was used ...
-
No products found
because this supplier's products are not listed.
Manmeet Bhalla, et al.,
bioRxiv - Microbiology 2021
Quote:
... Bacterial titers were confirmed by plating on tryptic soy agar plates supplemented with 5% sheep blood agar (Hardy Diagnostics).
-
No products found
because this supplier's products are not listed.
Fabian S. F. Hartmann, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... The working plate (96-well plate) was used as a source plate for robotic spotting using a ROTOR HDA benchtop robot (Singer Instruments, United Kingdom) on rectangular OmniTray plates (Singer Instruments ...
-
No products found
because this supplier's products are not listed.
Evan M. Hess, et al.,
bioRxiv - Neuroscience 2022
Quote:
... supplemented with 5% fetal bovine serum/5% horse serum (Atlanta Biologicals), Glutamax (Gibco) ...
-
No products found
because this supplier's products are not listed.
Adnan K. Syed, et al.,
bioRxiv - Microbiology 2020
Quote:
... Once the biofilms were grown for 24 hours they were washed three times with 200 μl of PBS at pH 7.5 and then resuspended in 200 μl of PBS at pH 7.5 and transferred to a filter plate (0.2-μm AcroPrep Advance 96-well filter plates no. 8019; Pall). 100 μl of the filtrate was then combined with 100 μl of 2 μM SYTOX Green (no ...