-
No products found
because this supplier's products are not listed.
Ankita Datey, et al.,
bioRxiv - Microbiology 2019
Quote:
The serum samples were also subjected to indirect ELISA to detect the presence of IgG antibodies against JEV using Porcine JE IgG ELISA Kit (Glory Science Co., Ltd, USA) in accordance with the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Aggeliki Tserga, et al.,
bioRxiv - Systems Biology 2021
Quote:
... Urinary albumin concentration was measured by ELISA using the AlbuWell kit (WAK-Chemie Medical GmbH, Steinbach, Germany). Urinary creatinine concentration was measured by the colorimetric method of Jaffe ...
-
No products found
because this supplier's products are not listed.
Filipy Borghi, et al.,
bioRxiv - Physiology 2021
Quote:
... 4 °C and analyzed using the commercial ELISA kit (Diagnostics Biochem Canada Inc. - Ref CAN-C-290) at the Laboratory of Stress Studies (LABEEST ...
-
No products found
because this supplier's products are not listed.
Alexandra M. Amen, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 10-30% confluent U-251 cells were transduced at low MOI in 12-well plates with the lentivirus EF1a-BFP_Rsv-Bsd (5 µl; GenTarget, #LVP365) or EF1a-hTERT_Rsv-Bsd (50 µl ...
-
No products found
because this supplier's products are not listed.
Xuwen Cao, et al.,
bioRxiv - Genetics 2021
Quote:
... C20:5 n3 (Larodan) and C18:0 ...
-
No products found
because this supplier's products are not listed.
Paola Moreno-Roman, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... with 5% NGS (Capralogics GS0250), washed 3 times in PBT ...
-
No products found
because this supplier's products are not listed.
Sara Meril, et al.,
bioRxiv - Cancer Biology 2023
Quote:
0.5 μg RNA was mixed with 4 μL 5X reaction buffer and 1 μL RTase (AzuraQuant cDNA synthesis kit, Azura Genomics cat: AZ1996). Reaction mix was incubated at 42°C for 30 min and denatured at 85°C for 10 min ...
-
No products found
because this supplier's products are not listed.
Christopher W. Bakerlee, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... and 1 mg/mL 5-fluoroorotic acid monohydrate (5-FOA) (Matrix Scientific, CAS[220141-70-8]) in S/MSG D media (1.71 g/L Yeast Nitrogen Base Without Amino Acids and Ammonium Sulphate ...
-
No products found
because this supplier's products are not listed.
Candice Chapouly, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5 μg of VEGFA (Shenandoah biotechnology diluted in 10 μL sterile phosphate-buffered saline (PBS ...
-
No products found
because this supplier's products are not listed.
Shinya Ohara, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Biocytin (5 mg/mL; Iris Biotech) was added to the internal solution in order to recover cell morphology ...
-
No products found
because this supplier's products are not listed.
Sangsoon Park, et al.,
bioRxiv - Cell Biology 2023
Quote:
... or 5 µM CHIR99021 (A133052, Ambeed) for 48 hours under serum-free conditions to stimulate cardiomyocyte hypertrophy or proliferation ...
-
No products found
because this supplier's products are not listed.
Sebastian Müller, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and ECM 6-well plates (Celprogen, #E36102-29-6Well). Primary human T-cells were cultured in RPMI 1640 medium (Gibco ...
-
No products found
because this supplier's products are not listed.
Roman Franěk, et al.,
bioRxiv - Zoology 2019
Quote:
... 5 μl PPP Master Mix (Top-Bio) and 3 μl PCR H2O (Top-Bio) ...
-
Native Antigen
Cat# AH01-100,
100µg USD $289.0
Ask
Maya Imbrechts, et al.,
bioRxiv - Immunology 2021
Quote:
The binding of the purified recombinant antibodies to the following SARS-CoV-2 antigens was assessed via ELISA: spike glycoprotein (S1) RBD-His (REC31849-500, The Native Antigen Company), RBD(N439K)-His (40592-V08H14 ...
-
No products found
because this supplier's products are not listed.
Ana J. Chucair-Elliott, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and positive fraction) and mouse methylation controls (#80-8063-MGHM-5 and #80-8064-MGUM-5; EpigenDX, Hopkinton, MA) were diluted in nuclease free elution buffer (Qiagen ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Jessica D. Warren, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Paclitaxel (Taxol) was used at 5 nM (Biotang). The following drugs were also used at the specified concentrations ...
-
No products found
because this supplier's products are not listed.
Mohamad Ibrahim Cheikh, et al.,
bioRxiv - Biophysics 2022
Quote:
... plates were covered in light halocarbon oil (Halocarbon Oil 27, Sigma). Embryos with a distinctive faint halo in the periphery ...
-
No products found
because this supplier's products are not listed.
Jayne T. Wolfe, et al.,
bioRxiv - Bioengineering 2023
Quote:
... A rectangular parallel plate flow chamber (#31-010, GlycoTech, Gaithersburg, MD) was placed on top of the cultured cells using vacuum pressure to form a seal ...
-
No products found
because this supplier's products are not listed.
Jaylissa Torres Robles, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Samples were boiled at 95ºC for 5 min and fractionated on 5% SDS-polyacrylamide gels with 25 nM Phos-tag reagent (Nard Institute AAL-107) and 50 μM MnCl2 as reported previously78 or by standard SDS-PAGE ...
-
No products found
because this supplier's products are not listed.
Apsra Nasir, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 5% Fetal Bovine Serum (FBS) (Peak Serum, PS-FB2), ITS (Lonza ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... The plates were revealed using TMB One as the substrate (Kementec, 4380A). All dilutions and washing were performed in barbital/tween buffer (4 mM sodium barbital ...
-
No products found
because this supplier's products are not listed.
Melpomeni Platani, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Screened compounds were selected from the appropriate chemical library plates containing Cloud library (Enamine) and an in-house library of publicly available compounds ...
-
No products found
because this supplier's products are not listed.
Honglin Jiang, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... A final concentration of 5 uM of SiRhoNox (FerroFarRed, GORYO Chemical) in a serum-free culture medium was added to the dish and incubate for 1 hour at 37°C ...
-
No products found
because this supplier's products are not listed.
Marie Ouarné, et al.,
bioRxiv - Cell Biology 2023
Quote:
... a stock of 50mg 5-ethynyl-2-deoxyuridine (EdU) (Alfagene, A10044) was diluted in 5mL of PBS to make a working solution (10mg/mL) ...
-
No products found
because this supplier's products are not listed.
Abrar Choudhury, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... whole skulls were subsequently embedded in 5% low-melt agarose (Precisionary) and cut into 300µm sections on a Vibratome (VT1000S ...
-
No products found
because this supplier's products are not listed.
Thibault Scalvenzi, et al.,
bioRxiv - Genomics 2021
Quote:
... 20 and 5 μm filters (nylon 40 μm cell strainer from BIOLOGIX; 20 μm net ring from Pharmacia Fine chemicals ...
-
No products found
because this supplier's products are not listed.
Mohammed Mohasin, et al.,
bioRxiv - Immunology 2021
Quote:
... Nuclei were stained with 5 µM Draq5 (Biostatus Ltd. 1:1000 in PBS). Coverslips were mounted onto microscope slides with a glycerol free poly-(vinyl alcohol ...
-
No products found
because this supplier's products are not listed.
Steffi Daniel, John D. Hulleman,
bioRxiv - Neuroscience 2022
Quote:
... fibulin-3 blocking peptide (5:1 to anti-fibulin-3 antibody, Prosci # 5213P). The next day ...
-
No products found
because this supplier's products are not listed.
Joseph C. Reynolds, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Membranes were blocked for 1 hour using 5% BSA (Akron Biotech, USA, #AK8905-0100) in tris-buffered saline containing 0.05% Tween-20 (Bio-Rad #161-0781 ...
-
No products found
because this supplier's products are not listed.
Kota Kaneko, et al.,
bioRxiv - Cell Biology 2023
Quote:
... PLC/PRF/5 cells were treated with HGF and SHP099 (10 μM; CHEMIETEK; CT-SHP099) or trametinib (10 nM ...
-
No products found
because this supplier's products are not listed.
Markus Hackl, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The NTA modified primer (backward primer, 5’-NTA-SS-C6-TCCAAAGGTGAAGAACTGTTCACC) was purchased from Gene Link, Inc ...
-
No products found
because this supplier's products are not listed.
Aaron A. Vogan, et al.,
bioRxiv - Genetics 2019
Quote:
... we inoculated HPM plates with either a polycarbonate Track Etched 76 mm 0.1 μm membrane disk (Poretics, GVS Life Sciences, USA)(Psk1xS5 and Psk7xS5 ...
-
No products found
because this supplier's products are not listed.
M. A. Rossotti, et al.,
bioRxiv - Bioengineering 2021
Quote:
... three-fold dilutions of VHH-Fcs were prepared in V- Bottom 96-well microtiter plates (Globe Scientific, Mahwah, NJ, Cat# 120130) and mixed with 50 µL of CHO-SPK cells ...
-
No products found
because this supplier's products are not listed.
Henriette Frikke-Schmidt, et al.,
bioRxiv - Physiology 2020
Quote:
... The plates for the islets were placed on a mat heated at 37 °C on a H101A ProScan motorized stage (Prior Scientific Instruments Ltd ...
-
No products found
because this supplier's products are not listed.
Alexander A. Choi, Limin Xiang, Wan Li, Ke Xu,
bioRxiv - Biophysics 2023
Quote:
... the coverslips were functionalized with 10 mg/mL methoxy PEG silane (5 kDa, M-SLN-5000, JenKem Technology) in 95% ethanol/water for 30 min ...
-
No products found
because this supplier's products are not listed.
Adebayo O. Shittu, Tomiwa Adesoji, Edet E. Udo,
bioRxiv - Microbiology 2020
Quote:
... aureus genotyping Kit 2.0 (Alere Technology, Jena, Germany) as described previously [10] ...
-
No products found
because this supplier's products are not listed.
Kathleen E. DelGiorno, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... slides were stained using a kit (IHC world) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Athanasios Papadas, et al.,
bioRxiv - Immunology 2021
Quote:
Paraffin-embedded murine tumor sections and unstained 4-5 μm-thick human lung carcinoma TMA (US Biomax Inc., BC041115e) sections were deparaffinized and rehydrated using standard methods ...
-
No products found
because this supplier's products are not listed.
Lauren G. Buss, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Cells were exposed to a single dose of 5 Gy irradiation (X-ray, RS 2000 Small Animal Irradiator, Rad Source). The untreated cells were shielded with >6 mm lead.
-
No products found
because this supplier's products are not listed.
Yodai Takei, et al.,
bioRxiv - Systems Biology 2020
Quote:
... The custom-made automated sampler was used to move designated readout probes in hybridization buffer from a 2.0 mL 96-well plate through a multichannel fluidic valve (IDEX Health & Science EZ1213-820-4) to the custom-made flow cell using a syringe pump (Hamilton Company 63133-01) ...
-
No products found
because this supplier's products are not listed.
Tanya Puccio, Karina S. Kunka, Todd Kitten,
bioRxiv - Microbiology 2021
Quote:
... Concentrations were determined by comparison with a standard curve created with a 10 μg ml−1 multi-element standard (CMS-5; Inorganic Ventures) diluted in 5% TMG nitric acid ...
-
No products found
because this supplier's products are not listed.
Julia Ledderose, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Time-pregnant female mice were injected intraperitoneally with 50 mg/kg BrdU (5-bromo-2’-deoxyuridine, BrdU; Accurate Chemical & Scientific Corporation) at E11.5 ...
-
No products found
because this supplier's products are not listed.
Shruti D Shah, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... samples were embedded in paraffin and sectioned at 5 microns on Starfrost adhesive slides (Mercedes Medical; Catalog #MER 7255/90/WH). Slides were deparaffinized in three xylene baths and then rehydrated in graded 100% to 70% alcohols ...
-
No products found
because this supplier's products are not listed.
Vera Vysochinskaya, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... or to 5 µL peptide/liposome complexes with siRNA and applied to a freshly cleaved mica (SPI Supplies, West Chester, PA, USA). The mixture was then incubated at room temperature for 1 minute ...
-
No products found
because this supplier's products are not listed.
Daisuke Shimura, et al.,
bioRxiv - Cell Biology 2021
Quote:
... using Mouse Mitochondrial DNA Copy Number Assay kit (Detroit R&D, Detroit, MI) for the samples from the mouse heart or Human Mitochondrial DNA Monitoring Primer Set (TaKaRa Bio ...
-
No products found
because this supplier's products are not listed.
Clotilde Laussel, et al.,
bioRxiv - Genetics 2022
Quote:
... The assay was performed using the 2DG uptake measurement kit (Cosmo Bio USA, Carlsbad ...
-
No products found
because this supplier's products are not listed.
Misato Okamoto Miyakawa, Hitoshi Miyakawa,
bioRxiv - Evolutionary Biology 2022
Quote:
... Samples were prepared using a CyStain UV Precise P Kit (Sysmex Partec., GmbH.). Each body ...
-
No products found
because this supplier's products are not listed.
Klaudyna Borewicz, et al.,
bioRxiv - Microbiology 2024
Quote:
... PCR products were then purified with the HighPrep® PCR kit (MagBio Genomics, Gaithersburg, MD, USA) and concentrations of indexed cDNA were measured using the Qubit®dsDNA BR Assay Kit (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Susan Paton, et al.,
bioRxiv - Microbiology 2021
Quote:
... RT-PCR was performed using the VIASURE SARS-CoV-2 Real Time PCR Detection Kit (Viasure; CerTest Biotec, Zaragoza, Spain), following the methods provided ...