-
LC Laboratories' Product Number E-5500 - Epothilone B, Free Base (EPO-906, EpoB, Patupilone,...
Cat# E-5500, SKU# E-5500_2mg,
2 mg, $51.00
Ask
Jorge Iván Castillo-Quan, et al.,
bioRxiv - Cell Biology 2022
Quote:
... (LC laboratories: B-1408) which was directly added io the NGM during plate pouring at 200 μM (stock diluted in DMSO at 50 mM) ...
-
No products found
because this supplier's products are not listed.
Toby S. Turney, Vivian Li, Stephen G. Brohawn,
bioRxiv - Neuroscience 2021
Quote:
... 1% n-Dodecyl-b-D-Maltopyranoside (DDM, Anatrace, Maumee, OH), 0.2% Cholesterol Hemisuccinate Tris Salt (CHS ...
-
Chromatographically purified. A solution in 100 mM sodium chloride. Chymotrypsin and trypsin ² 0.02%.
Cat# LS005302,
Bulk, Inquire
Ask
Tiffany Shi, et al.,
bioRxiv - Immunology 2023
Quote:
... 10mg/mL collagenase type IV from clostridium histolyticum (Worthington, LS004186), 250U DNase I (Roche ...
-
No products found
because this supplier's products are not listed.
Wenrui Huang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Sudan Black B (EMS 21610) solution at 0.1% m/v in 30% MQ water and 70% ethanol was placed on the sections for 20 minutes ...
-
Cat# HY-101267-10 mg,
10 mg, USD $550.0
Ask
Kruno Vukušić, Iva M. Tolić,
bioRxiv - Cell Biology 2023
Quote:
... Aurora B inhibitor ZM-447439 (MedChemExpress, IC50 value 130 nM ...
-
No products found
because this supplier's products are not listed.
Dawson D. Kerns, et al.,
bioRxiv - Pathology 2023
Quote:
Purified Vip3Aa (25 µg) and Cry1Ac (1 µg) toxins were radiolabeled with 0.5 mCi of NaI125 (Perkin Elmer) using chloramine T ...
-
No products found
because this supplier's products are not listed.
Rosy P. Cárdenas-Sandoval, et al.,
bioRxiv - Bioengineering 2021
Quote:
Soft cantilevers T R400P B (Olympus, Japan) with a nominal spring constant of 0.09 N/m ...
-
No products found
because this supplier's products are not listed.
Marco Canella, et al.,
bioRxiv - Cell Biology 2023
Quote:
Foxl1-Cre mice50 were crossed with Rosa-inducible diphtheria toxin receptor (iDTR)51 mice (Jackson Laboratories Bar Harbor, ME #007900) and or Rosa-membrane-targeted dimer tomato protein (mT ...
-
No products found
because this supplier's products are not listed.
Rachael Deis, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... and mouse anti-b-Actin antibody (Jackson ImmunoResearch, #111-035-003). Membranes were washed 3x for 10min in 1X TBST and incubated with the secondary antibody ...
-
No products found
because this supplier's products are not listed.
K. M. Pruss, et al.,
bioRxiv - Microbiology 2020
Quote:
... composed of Clostridium difficile Agar Base (OxoiD) with 7% v/v of Defibrinated Horse Blood (Lampire Biological Laboratories), supplemented with 32 mg/L Moxalactam (Santa Cruz Biotechnology ...
-
No products found
because this supplier's products are not listed.
Lise Hunault, et al.,
bioRxiv - Microbiology 2023
Quote:
... anti-toxin B biotinylated antibody (BBI solutions, Madison, WI) followed by high sensitivity Streptavidin-HRP conjugate (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Ruizhi Tao, et al.,
bioRxiv - Microbiology 2023
Quote:
Clostridium butyricum (ATCC 19398) and Clostridium tyrobutyricum (ATCC 25755) and were purchased from American Type Culture Collection (ATCC, Manassas, USA). Akkermansia muciniphila (DSM 22959 ...
-
No products found
because this supplier's products are not listed.
Eleonora Lomi, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Four retrograde tracers were employed for a total of 29 injections: (i) cholera toxin subunit B (CTB; Polysciences Inc, Eppelheim, Germany), (ii ...
-
No products found
because this supplier's products are not listed.
Lucy R. Frost, et al.,
bioRxiv - Microbiology 2023
Quote:
... difficile as described above were washed thrice with PBS to remove unadhered bacteria and fixed with 4% paraformaldehyde (PFA) (Alfa Aesar, USA) for 15 min at RT ...
-
No products found
because this supplier's products are not listed.
Seong Su Kang, et al.,
bioRxiv - Neuroscience 2019
Quote:
... MAO-B (GeneTex), MAO-A (GE healthcare) ...
-
No products found
because this supplier's products are not listed.
Heather R. Keys, Kristin A. Knouse,
bioRxiv - Genomics 2021
Quote:
... monoamine oxidase B (MAO-B) (1:1,000, Novus Biologicals NBP1-87493), lamin B2 (1:1,000 ...
-
No products found
because this supplier's products are not listed.
Maxime Penisson, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 6 % agarose (LE-8200-B, Euromedex) PBS solution ...
-
No products found
because this supplier's products are not listed.
Xavier Leray, et al.,
bioRxiv - Biophysics 2021
Quote:
... Magic red Cathepsin-B essay (ImmunoChemistry Technologies).
-
No products found
because this supplier's products are not listed.
Zhouyi Rong, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Variant Lineage B.1.1.7 (S1N-C52Hg, Acrobiosystems), HA Recombinant Influenza A Virus Protein ...
-
No products found
because this supplier's products are not listed.
Michel G. Tremblay, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and transferred to a Biodyne B membrane (Pall). The membrane was UV cross-linked at 70 J/cm2 ...
-
No products found
because this supplier's products are not listed.
Paul V. Hickner, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... and Sobral 1S-B and Jacobina-A (3MαH).
-
No products found
because this supplier's products are not listed.
Yixuan Huang, et al.,
bioRxiv - Microbiology 2023
Quote:
... LAMBDA 10-B Smart Shutter from Sutter Instrument, an OkoLab stage incubator ...
-
No products found
because this supplier's products are not listed.
Mark S. Ladinsky, et al.,
bioRxiv - Cell Biology 2020
Quote:
... placed individually into brass planchettes (Type A/B; Ted Pella, Inc.), and rapidly frozen with a HPM-010 High Pressure Freezing machine (BalTec/ABRA) ...
-
No products found
because this supplier's products are not listed.
Roxane Verdikt, et al.,
bioRxiv - Microbiology 2021
Quote:
... Antibodies against MBD1 (pAb-078-050) and UHRF1 (H00029128-B01P) were purchased from Diagenode and Abnova ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
The optimal receptor-binding domain (OBD) (100, 100) of Tetanus Toxin (Heavy Chain/B Subunit) was synthesized by GENEWIZ (incorporating flanking 5’ Hindlll and 3’ Nco1 restriction sites ...
-
No products found
because this supplier's products are not listed.
Daniel A. Pensinger, et al.,
bioRxiv - Microbiology 2022
Quote:
... difficile agar base (Oxoid) supplemented with 7% defibrinated horse blood (HemoStat Laboratories), 32 mg/L moxalactam (Santa Cruz Biotechnology) ...
-
No products found
because this supplier's products are not listed.
Osita W. Ogujiofor, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... An approximate total of 500-750 nL of Cholera toxin subunit B (CTB) AlexaFluor 488 or 647 Conjugate (Invitrogen) (Nanoject II, Drummond Scientific) was injected into 2-3 different locations in the left forepaw (Intrinsic Hand (IH ...
-
No products found
because this supplier's products are not listed.
Fernando Ferreira, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... the peptide toxin GsMTx4 (Smartox Biotechnology, 08GSM001) wasdissolved in H2O in a stock of 200 µM and stored at −80 °C ...
-
No products found
because this supplier's products are not listed.
Yanan Yang, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 8 ng/mL Cholera Toxin (CELL technologies), 5 ng/mL insulin (CELL technologies) ...
-
No products found
because this supplier's products are not listed.
Johann Peltier, et al.,
bioRxiv - Microbiology 2020
Quote:
... difficile strains was estimated by quantitative PCR on genomic DNA extracted using the NucleoSpin Microbial DNA kit (Macherey-Nagel). The total chromosome copy number was quantified based on the reference gene dnaF (CD1305 ...
-
No products found
because this supplier's products are not listed.
Romain Durand, et al.,
bioRxiv - Genomics 2023
Quote:
... hygromycin B (BioShop Canada), G418 (BioShop Canada) ...
-
No products found
because this supplier's products are not listed.
Amelia Foss, et al.,
bioRxiv - Biophysics 2020
Quote:
... and 2% amphotericin B (Euroclone) and maintained under hypoxic conditions (1% O2 ...
-
No products found
because this supplier's products are not listed.
Katja R. Kasimatis, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... hygromycin B (A.G. Scientific, Inc.) was added to the plates at a final concentration of 250μg/ml ...
-
No products found
because this supplier's products are not listed.
Namita Chatterjee, et al.,
bioRxiv - Cell Biology 2020
Quote:
... ERN1 (Cat: SR301457A&B, Origene), siRNA Negative Control (Cat ...
-
No products found
because this supplier's products are not listed.
Himani Sharma, et al.,
bioRxiv - Cancer Biology 2024
Quote:
Biotinylated β-galactosidase (B-βG) and Biotin Alkaline Phosphatase Conjugated (B-ALP) were purchased from Rockland Immunochemicals (PA ...
-
No products found
because this supplier's products are not listed.
Timothy J. Aikin, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Prime 95-B sCMOS camera (Photometrics) and a Multiline laser launch (Cairn Research ...
-
No products found
because this supplier's products are not listed.
Patrick J. Madden, et al.,
bioRxiv - Immunology 2022
Quote:
... DOTA-NHS-ester (#B-280, Macrocyclics) was dissolved in dimethyl sulfoxide (DMSO ...
-
No products found
because this supplier's products are not listed.
Sean Froudist-Walsh, et al.,
bioRxiv - Neuroscience 2020
Quote:
... with threshold b (Abbott and Chance 2005).
-
No products found
because this supplier's products are not listed.
Jörg Schweiggert, et al.,
bioRxiv - Cell Biology 2021
Quote:
... energy regeneration solution (B-10, Boston Biochem) in assay buffer were carefully pipetted directly on the arrays ...
-
No products found
because this supplier's products are not listed.
Samuel S.H. Weng, et al.,
bioRxiv - Biochemistry 2019
Quote:
... and plasma and bone marrow interstitial fluid samples from three pediatric B-ALL patients (B-ALL-1, −2, −3) were processed on an epMotion M5073 automated liquid handling system (Eppendorf) controlled by an EasyCon tablet (Eppendorf) ...
-
No products found
because this supplier's products are not listed.
Célie Cokelaere, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... coated culture flasks in TEpiCM-b medium (#2561-b) supplemented with TEpiCGS (#2572) and 5 mL penicillin/streptomycin (#0503) (all from Sciencell). All experiments were performed with Mycoplasma-free cells (regularly tested with Venor™ GeM ...
-
No products found
Evelien Eenjes, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 10 μg/mL PureCol (Advanced Biomatrix; 5005-B) for 2 hrs at 37°C ...
-
No products found
because this supplier's products are not listed.
Mohamad El Shami, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... amphotericin B (250 ng/mL, Gemini Bio-Products 400104), and Plasmocin (2.5 mg/mL ...
-
No products found
because this supplier's products are not listed.
Nadège Gouignard, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... at 100 μg/mL or Magenta-Phos (Biosynth, B-7452). The following probes were used ...
-
No products found
because this supplier's products are not listed.
Bing Han, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
No products found
because this supplier's products are not listed.
Manuel Albanese, et al.,
bioRxiv - Cell Biology 2020
Quote:
Human primary B cells were prepared from adenoidal mononuclear cells by Ficoll Hypaque (PAN Biotech) gradient centrifugation (as described in Albanese et al. ...
-
No products found
because this supplier's products are not listed.
Aurora Alvarez-Buylla, et al.,
bioRxiv - Physiology 2023
Quote:
... we used the Zymo RiboFree Total RNA Library Prep kit (R3003-B, Zymo Research, Irvine, CA) following manufacturer instructions ...
-
No products found
because this supplier's products are not listed.
Travis B. Kinder, et al.,
bioRxiv - Immunology 2020
Quote:
300 HLA-B HiBit cells/well were plated into white 1536-well plates (Greiner, Monroe, NC, 789173-F) in 5 uL/well of GM using a Multidrop Combi (Thermo Scientific) ...
-
No products found
because this supplier's products are not listed.
Theresa Mau, et al.,
bioRxiv - Epidemiology 2019
Quote:
... difficile targeting the 23S rRNA gene (Charles River Laboratories, Wilmington, MA). Cecum and colon tissues as well as tissues from other organs were fixed in 10% neutral buffered formalin for a minimum of 24 hours and then routinely processed to paraffin ...
-
No products found
because this supplier's products are not listed.
K. Saini, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... (3Helix, Inc., B-CHP) and fluorescent Streptavidin conjugate Alexa-594 (Thermofisher -S11227 ...