-
No products found
because this supplier's products are not listed.
Joshua Victor, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... phospho-Chk1 (Abcam, ab92630, Rabbit mAb) at 1:500 with 0.01% Tween-20 ...
-
No products found
because this supplier's products are not listed.
Dan Sarni, et al.,
bioRxiv - Cell Biology 2021
Quote:
... rabbit anti-phosphorylated CHK1 (Cell Signaling, 1:200), rabbit anti-GAPDH (Cell Signaling ...
-
No products found
because this supplier's products are not listed.
Daan M.K. van Soest, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Chk1 (Santa Cruz, SC8408), pChk2 T68 (Cell Signaling ...
-
No products found
because this supplier's products are not listed.
Shivangi Khanna, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Total CHK1 (Invitrogen PA512096), pATR (CST 2853) ...
-
No products found
because this supplier's products are not listed.
Marina Dall’Osto, et al.,
bioRxiv - Cell Biology 2021
Quote:
... the 3’UTR of Chk1 (3’Chk1) (5’CUGGUGAAUAUAGUGCUGCUA3’ from Sigma-Aldrich), Polι (SMART pool ...
-
No products found
because this supplier's products are not listed.
John T. Killian Jr., et al.,
bioRxiv - Immunology 2023
Quote:
... Recombinant human IgG1 mAbs were synthesized (Sino Biological) using the AA sequences derived from the predicted UCA nucleotide sequences.
-
No products found
because this supplier's products are not listed.
Demin Du, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... CHK1 (Proteintech, 25887-1-AP), MSH2 (Proteintech ...
-
No products found
because this supplier's products are not listed.
Zoya Mann, et al.,
bioRxiv - Cell Biology 2023
Quote:
Rabbit mAb against NMIIB (Biolegend, Cat#909901)
-
No products found
because this supplier's products are not listed.
Ingrid R. Niesman,
bioRxiv - Cell Biology 2020
Quote:
... (Abcam; CHOP mAb #2895T, GFP rabbit mAb #2956T Novus Biologicals; TGN38 mAb #NB300-575SS ...
-
No products found
because this supplier's products are not listed.
Cemil Kerimoglu, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... NESTIN mouse mAb (BD), RC2 mouse mAb (Developmental Studies Hybridoma Bank),
-
No products found
because this supplier's products are not listed.
Li-Feng-Rong Qi, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... GRB2 Rabbit mAb (cat. No. A19059, ABclonal, China), ERK1/ERK2 Rabbit pAb (cat ...
-
No products found
because this supplier's products are not listed.
Laurelle Jackson, et al.,
bioRxiv - Microbiology 2021
Quote:
... a rabbit anti-spike monoclonal antibody (mAb BS-R2B12, GenScript A02058) was used at 0.5μg/mL as the primary detection antibody ...
-
No products found
because this supplier's products are not listed.
Darrell R. Kapczynski, et al.,
bioRxiv - Microbiology 2021
Quote:
... and rabbit anti-Spike MAb (Origene), diluted as above ...
-
No products found
because this supplier's products are not listed.
Stefanie Jehle, et al.,
bioRxiv - Systems Biology 2021
Quote:
... secondary mAB anti-rabbit (donkey, GE Healthcare, LNA934V);
-
No products found
because this supplier's products are not listed.
Hataf Khan, et al.,
bioRxiv - Microbiology 2020
Quote:
... Cells were then cultured with 2 μg/ml of plate-bound anti-CD3 and anti-CD28 monoclonal antibodies (αCD3αCD28 stimulation) (mAbs) (eBioscience) and 25 U/ml of recombinant human interleukin-2 (IL-2; Roche Applied Science) at a concentration of 1.5-2 × 106 cells/ml in RPMI supplemented with 10% heat-inactivated Human Serum (HS ...
-
No products found
because this supplier's products are not listed.
Benedetta Mattorre, et al.,
bioRxiv - Biochemistry 2022
Quote:
... anti-ERAP2 (mAb clone 3F5, MAB 3830 R&D Systems) (25) ...
-
No products found
because this supplier's products are not listed.
Eloise Clarkson, Annabelle Lewis,
bioRxiv - Cancer Biology 2024
Quote:
... 1% mouse recombinant EGF (Invitrogen, 5% Recombinant human R-spondin (Peprotech).
-
No products found
because this supplier's products are not listed.
Yong-jie Xu, et al.,
bioRxiv - Genetics 2023
Quote:
... the membrane was blotted with the Chk1-pS345 antibody at the 1:3000 dilution for 3 h to detect the phosphorylated Chk1-Ser345 in ChemiDoc (Bio-Rad). The membrane was stripped ...
-
No products found
because this supplier's products are not listed.
Tomoaki Sobajima, et al.,
bioRxiv - Cell Biology 2023
Quote:
... CENP-A (mouse mAb, AbCam, ab13939; mouse mAb, GeneTex, GTX13939), CENP-C (guinea pig pAb ...
-
No products found
because this supplier's products are not listed.
Ekapot Singsuksawat, et al.,
bioRxiv - Microbiology 2020
Quote:
... Cells were then intracellularly stained with 4G2 mAbs followed by rabbit anti-mouse Igs FITC (Dako). The cells were fixed with 1% formaldehyde and analyzed on BD LSRFortessa ...
-
No products found
because this supplier's products are not listed.
Stephanie M. Ackerson, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... CHK1 (Bethyl, A300-298A), CHK1 S317 (Bethyl ...
-
No products found
because this supplier's products are not listed.
Dorothea Höpfner, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Recombinant rabbit anti-pan-ADP-ribose binding reagent MABE1016 (Merck Millipore) was used 1:1000 ...
-
No products found
because this supplier's products are not listed.
David Sitbon, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... we produced recombinant H3 mutant proteins from mRNAs using rabbit reticulocyte lysate (Promega L4600). After 3h of incubation at 4°C in interphase extracts followed by another 3h incubation with anti-HA beads ...
-
No products found
because this supplier's products are not listed.
Anngela C. Adams, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... κ isotype control mAb (BioXCell, Lebanon ...
-
No products found
because this supplier's products are not listed.
Yuhao Wang, Linhao Ruan, Rong Li,
bioRxiv - Cell Biology 2023
Quote:
... mAb clone JL-8 (632381) from Takara Bio ...
-
No products found
because this supplier's products are not listed.
Clément Demongin, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Primary antibodies for FUS (α-FUS rabbit, mAB ABnova) and TDP-43 (α-TDP-43 mousse ...
-
No products found
because this supplier's products are not listed.
Courtney F. Jungers, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... or without 350 units of recombinant GSK3β (rabbit skeletal muscle) (New England BioLabs) and 1X hot kinase buffer (50mM Tris ...
-
No products found
because this supplier's products are not listed.
R Ragazzini, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... H3 mAb (39163) and H3K27me2 mAb (61435) were purchased from Active Motif. Polyclonal Rabbit one against H3 from Cell Signaling Technology (9715) ...
-
No products found
because this supplier's products are not listed.
Nina Kirstein, et al.,
bioRxiv - Cell Biology 2020
Quote:
... rabbit anti-H4K20me3 (Diagenode, MAb-057-050), or IgG isotype controls for 16h at 4°C ...
-
No products found
because this supplier's products are not listed.
Mohammad M. Sajadi, et al.,
bioRxiv - Immunology 2021
Quote:
... 0.5 μg/mL anti-CD40 mAb (Miltenyi Biotec) and CXCR5 antibody were added ...
-
No products found
because this supplier's products are not listed.
Niko Moses, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Flag-Chk1 was purchased from Addgene (22894). The plasmids were transiently or stably transfected into cells using Lipofectamine 2000 (Invitrogen).
-
No products found
because this supplier's products are not listed.
Mariana F. Tioni, et al.,
bioRxiv - Immunology 2021
Quote:
... Mab MT57 (Mabtech), were absorbed on plates instead of spike antigen ...
-
No products found
because this supplier's products are not listed.
Katarzyna Olga Rojek, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Human recombinant VEGF-165 (Stemcell technologies; Saint Egrève ...
-
No products found
because this supplier's products are not listed.
Kelsey Briggs, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... rabbit anti-Spike MAb (Origene, Rockland, Maryland), diluted 1:250 ...
-
No products found
because this supplier's products are not listed.
David Gonzalez-Perez, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Secondary antibody anti-Rabbit IgG conjugated to HRP (Goat mAb, Vector Laboratories, 1:8,000) was used for detection of proteins using SuperSignal West Pico PLUS Chemiluminescent Substrate (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Krisztina Ötvös, et al.,
bioRxiv - Plant Biology 2019
Quote:
... The purified recombinant protein was used to immunize rabbits by a company (Eurogentec). From the immunserum a crude IgG fraction was isolated by ammonium sulfate precipitation then IgG was further purified on protein gel blots of the antigen ...
-
No products found
because this supplier's products are not listed.
Martin Pauli, et al.,
bioRxiv - Neuroscience 2019
Quote:
... rabbit polyclonal and mAb anti-Zinc transporter 3 (ZnT3) (Synaptic Systems 197 002 and 197 011, 1:500). Secondary antibodies were used in the following concentrations ...
-
No products found
because this supplier's products are not listed.
Kostantin Kiianitsa, Nancy Maizels,
bioRxiv - Biochemistry 2020
Quote:
... a rabbit polyclonal raised against recombinant PARP1 (Enzo Life Sciences ALX-210-302-R100; 1:4000 dilution); anti-N-ter-PARP1 ...
-
No products found
because this supplier's products are not listed.
Melissa Lim, et al.,
bioRxiv - Biochemistry 2024
Quote:
Recombinant DCAF16 (MyBioSource.com, MBS1375983) (0.1μg/sample ...
-
No products found
because this supplier's products are not listed.
Cansu Yildirim, et al.,
bioRxiv - Neuroscience 2023
Quote:
... recombinant mouse IFNγ (Immunotools, #12343537), recombinant mouse IL4 (Immunotools ...
-
No products found
because this supplier's products are not listed.
Gonzalo P. Solis, et al.,
bioRxiv - Cell Biology 2022
Quote:
... mAb anti-His6 (34650; IF: 1/500) from Qiagen, mAb anti-GAPDH (GTX28245 ...
-
No products found
because this supplier's products are not listed.
Wai Tuck Soh, et al.,
bioRxiv - Microbiology 2020
Quote:
... anti-rat IgG-APC mAb (Jackson ImmunoResearch, West Grove, PA, USA).
-
No products found
because this supplier's products are not listed.
Hsuan-Yuan (Sherry) Wang, et al.,
bioRxiv - Immunology 2022
Quote:
... 2M7 mAb isolated from rabbit PBMCs was detected with an HRP-conjugated polyclonal mouse anti-rabbit IgG (Southern Biotech) and all the positive controls were detected with an HRP-conjugated polyclonal goat anti-human IgG (Southern Biotech ...
-
No products found
because this supplier's products are not listed.
Vien Nguyen, et al.,
bioRxiv - Neuroscience 2021
Quote:
... CC1 (APC, Mouse Mab OP80, Calbiochem), Nkx2.2 (Mouse Mab 74.5A ...
-
No products found
because this supplier's products are not listed.
Ivan Martinez-Valbuena, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Recombinant α-synuclein (rPeptide) was thawed from −80 ◦C storage ...
-
No products found
because this supplier's products are not listed.
Tania Christova, et al.,
bioRxiv - Neuroscience 2023
Quote:
... recombinant GST (SignalChem #G52-30U) and GST-LTK (SignalChem #L11-11G ...
-
No products found
because this supplier's products are not listed.
Awadalkareem Adam, et al.,
bioRxiv - Immunology 2021
Quote:
... Human recombinant ACE2-Fc-tag (Raybiotech) was then added at 1 μg/mL and incubated overnight at 4 °C ...
-
No products found
because this supplier's products are not listed.
Maria Tello-Lafoz, et al.,
bioRxiv - Immunology 2020
Quote:
... ECD-labeled anti-CD56 mAb (Beckman Coulter), BV650-labeled anti-CD3 mAb (clone UCHT1 ...
-
No products found
because this supplier's products are not listed.
Katrina Forrestall, et al.,
bioRxiv - Microbiology 2023
Quote:
... Recombinant PLpro (BPS Biosciences, 100735) was provided in a formulation of 40 mM Tris-HCl buffer (pH 8) ...
-
No products found
because this supplier's products are not listed.
Yann Aquino, et al.,
bioRxiv - Genomics 2022
Quote:
... Recombinant IFNα17/αI (PBL Assay Science) was used as calibrator ...