-
No products found
because this supplier's products are not listed.
Elena Martinez-Terroba, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and growth factors secreted by indicated cells were detected in conditioned media (CM) using RayBio Human Angiogenesis Antibody array C1000 (RayBiotech) and Proteome Profiler Human Protease Array Kit (R&D systems ...
-
No products found
because this supplier's products are not listed.
NV DiBenedetto, et al.,
bioRxiv - Microbiology 2023
Quote:
... difficile binary toxin subunit B capture and detection antibodies (MyBiosource) were used following the supplier’s instructions.
-
Cell strainers (Falcon), components of the NCIS kit. Suitable for removal of tissue debris in...
Cat# LK003265,
5 ea, $50.00
Ask
Wener Li, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... cells were incubated with 1 mg/ml collagenase B (Worthington Biochemical) for 1 hour at 37°C ...
-
No products found
because this supplier's products are not listed.
Jing Li, et al.,
bioRxiv - Cell Biology 2019
Quote:
... containing growth factor supplement and 10% fetal bovine serum (FBS, Cat. 6912, Cell Biologics Inc.); 0.25% Trypsin-EDTA solution (Cat ...
-
LC Laboratories' Product Number E-5500 - Epothilone B, Free Base (EPO-906, EpoB, Patupilone,...
Cat# E-5500, SKU# E-5500_2mg,
2 mg, $51.00
Ask
Jorge Iván Castillo-Quan, et al.,
bioRxiv - Cell Biology 2022
Quote:
... (LC laboratories: B-1408) which was directly added io the NGM during plate pouring at 200 μM (stock diluted in DMSO at 50 mM) ...
-
No products found
because this supplier's products are not listed.
Aude Guénolé, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... RNF219 specific antibodies were produced using an internal (RNF219-A) or C-terminal (RNF219-B) peptide by Abnova (Taiwan). Secondary antibodies were purchased from Cell Signaling Technology (goat anti-mouse IgG HRP-linked ...
-
No products found
because this supplier's products are not listed.
Tom Miclot, et al.,
bioRxiv - Biophysics 2020
Quote:
... Cells were incubated with anti-DNA/RNA G-quadruplex [BG4] primary antibody (Ab00174-1.1, Absolute Antibody) diluted at 1:200 in PBS-containing 2% BSA for 30 minutes at 37°C ...
-
No products found
because this supplier's products are not listed.
Fatimata Bintou Sall, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... GRANTA-519 and B-cells purified from four MCL patients using the NucleoSpin® RNA II kit according to the manufacturer’s protocol (Macherey-Nagel, Oensingen, Switzerland). A minimum of 2µg per samples were used for analysis ...
-
No products found
because this supplier's products are not listed.
Eva Rossmanith, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and HUVECs with a rabbit anti-human von Willebrand factor (vWF) mAb (2 μg/ml, Dianova, German) followed by goat anti-rabbit lgG Alexa Fluor® 594 (1:500 ...
-
No products found
because this supplier's products are not listed.
Bahareh Haddad Derafshi, et al.,
bioRxiv - Cell Biology 2021
Quote:
... we dissociated stem cells into single cells with Accutase (Innovative Cell Technologies) and seeded at ~ 40K cells into one 24 well plate pre-coated with Matrigel (BD Biosciences ...
-
No products found
because this supplier's products are not listed.
Philipp Radler, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Cells were lysed using a cell disrupter (Constant Systems; Cell TS 1.1) at a pressure of 1.36 kbar and subsequently incubated with 2.5 mM MgCl2 and 1 mg ml−1 DNase for 15 min ...
-
12 well plate with tissue culture treated #1.5 glass-like polymer cover slip (0.175±0.010mm)....
Cat# P12-1.5P,
20/case, $221.00
Ask
Rashmi J. Kumar, et al.,
bioRxiv - Cell Biology 2020
Quote:
... cells were transferred onto 12 well Cell-Tak coated glass plates (Cellvis), at a concentration of 50,000 cells/well for imaging ...
-
No products found
because this supplier's products are not listed.
Mahlon Collins, Yang Li, Robert Bowser,
bioRxiv - Neuroscience 2019
Quote:
... mouse monoclonal anti-scaffold attachment factor B (SAFB, Lifespan Biosciences, Seattle, WA, USA, 1:100), mouse monoclonal anti-SAFB (Proteintech ...
-
No products found
because this supplier's products are not listed.
Ami Vadgama, et al.,
bioRxiv - Immunology 2023
Quote:
... 0.3-30μM thrombin-receptor activating peptide 6 (TRAP-6; Cambridge Biosciences); 0.3-30μM U46619 (Enzo Life Sciences) ...
-
No products found
because this supplier's products are not listed.
Pablo Alcón, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... the reaction contained 75 nM of E1 ubiquitin activating enzyme (Boston Biochem), 0.8 µM E2 (UBE2T)18 ...
-
No products found
because this supplier's products are not listed.
Nadine Kluser, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 1 % Pen/Strep and 5 ng/ml basic fibroblast growth factor (b-FGF, Fitzgerald Industries, Acton, USA) and were seeded in T300 tissue culture flasks (TPP ...
-
No products found
because this supplier's products are not listed.
Joaquín Miguel Pellegrini, et al.,
bioRxiv - Immunology 2020
Quote:
... Cells were then incubated with mouse anti-human LC3A/B antibody (MBL International, M152-3) for 20 min ...
-
No products found
because this supplier's products are not listed.
Fenghua Qian, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 25 ng/mL mouse recombinant (mr) stem cell factor (Gemini bio-products), 25 ng/mL mrFlt3L (Pepro Tech) ...
-
No products found
because this supplier's products are not listed.
Jian Zhang, et al.,
bioRxiv - Immunology 2022
Quote:
... were cocultured with autologous memory B cells (5×104 cells) in the presence of 100 ng/ml staphylococcal enterotoxin B (SEB) (Toxin Technology, Sarasota, FL, USA) and RPMI 1640 medium supplemented with 10% FBS in 96-well U-bottom plates for 6 days ...
-
No products found
because this supplier's products are not listed.
Mathieu Neault, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... according to the manufacturer’s instructions using an anti-Factor VIII antibody (Biocare Medical, Concord, CA, USA). Detection of tissue-bound primary antibody was performed using the Bond Intense R Detection System (Leica Biosystems) ...
-
No products found
because this supplier's products are not listed.
Qianhui Qu, et al.,
bioRxiv - Biophysics 2021
Quote:
... Cell membrane was solubilized in n-dodecyl-b-D-maltoside (DDM, Anatrace) and 3-[(3-Cholamidopropyl)-dimethylammonio]-1-propanesulphonate (CHAPS ...
-
Tabalumab (Anti-TNFSF13B / BAFF / CD257) is a humanised monoclonal antibody BAFF (B-cell...
Cat# A3093, SKU# A3093-1mg*5,
1mg*5, $970.00
Ask
Bo-Ruei Chen, et al.,
bioRxiv - Cell Biology 2021
Quote:
... abl pre-B cells were treated with 3 μM imatinib (Selleck Chemicals, S2475) for 2 (for chromatin-bound RPA assay ...
-
No products found
because this supplier's products are not listed.
Pere Català, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 10 ng/ml epidermal growth factor (Amsbio), and 100 IU/mL penicillin-streptomycin (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Amelia Foss, et al.,
bioRxiv - Biophysics 2020
Quote:
... and 2% amphotericin B (Euroclone) and maintained under hypoxic conditions (1% O2 ...
-
No products found
because this supplier's products are not listed.
Sonam Gurung, et al.,
bioRxiv - Genetics 2023
Quote:
... respectively (BioSpec B-GA 12S2), 86 mm volume coil ...
-
No products found
because this supplier's products are not listed.
Gabriella Fioravanti, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 50 ng/mL nerve growth factor (Envigo NGF 2.5S), or 5nM ...
-
No products found
because this supplier's products are not listed.
Maxime Penisson, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 6 % agarose (LE-8200-B, Euromedex) PBS solution ...
-
No products found
because this supplier's products are not listed.
Michel G. Tremblay, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and transferred to a Biodyne B membrane (Pall). The membrane was UV cross-linked at 70 J/cm2 ...
-
No products found
because this supplier's products are not listed.
Paul V. Hickner, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... and Sobral 1S-B and Jacobina-A (3MαH).
-
No products found
because this supplier's products are not listed.
Yixuan Huang, et al.,
bioRxiv - Microbiology 2023
Quote:
... LAMBDA 10-B Smart Shutter from Sutter Instrument, an OkoLab stage incubator ...
-
No products found
because this supplier's products are not listed.
Nina Tanaskovic, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Apoptosis in bone-marrow derived B-cells was measured with the CaspGLOW™ Red Active Caspase Staining Kit (BioVision, #K190) following manufacturer’s guidelines ...
-
No products found
because this supplier's products are not listed.
Marie-Christin Baune, et al.,
bioRxiv - Plant Biology 2019
Quote:
... Polyclonal rabbit antisera were obtained from Eurogentec (Seraing, B), raised against the N-terminal GPT sequences (91 amino acids of GPT1 or 92 amino acids of GPT2 ...
-
No products found
because this supplier's products are not listed.
Alice Mazzagatti, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... cells were incubated with primary antibodies according to suppliers’ instructions: CREST (Antibodies Incorporated, 15-234-0001), γH2aX (Millipore ...
-
No products found
because this supplier's products are not listed.
Zaili Luo, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Cells were then resuspended in 100 μl cold Antibody Buffer and 1□0μl antibody (H3K4me3, EpiCypher #13-0041 ...
-
No products found
because this supplier's products are not listed.
Mark S. Ladinsky, et al.,
bioRxiv - Cell Biology 2020
Quote:
... placed individually into brass planchettes (Type A/B; Ted Pella, Inc.), and rapidly frozen with a HPM-010 High Pressure Freezing machine (BalTec/ABRA) ...
-
No products found
because this supplier's products are not listed.
Xufeng Xie, et al.,
bioRxiv - Microbiology 2024
Quote:
... Group 2: Polymyxin B (PMB) (1 mg/kg, i.p., Solarbio, China); Group 3 ...
-
No products found
because this supplier's products are not listed.
Stefano Musardo, et al.,
bioRxiv - Neuroscience 2021
Quote:
... cells were incubated with primary antibody (Oxytocin, 1/10000 dilution, Immunostar #20068 ...
-
No products found
because this supplier's products are not listed.
Paul J. Hoover, et al.,
bioRxiv - Immunology 2023
Quote:
... Mixed RNAscope (Advanced Cell Diagnostics)/antibody antigen retrieval and staining with Opal (Akoya Biosciences) fluorophores was performed manually following the RNAscope Multiplex Fluorescent v2 Assay combined with the immunofluorescence protocol (322818-TN ...
-
No products found
because this supplier's products are not listed.
Aikaterini Kalamari, et al.,
bioRxiv - Animal Behavior and Cognition 2020
Quote:
... except for 7 pairs of males from pilot experiment B that originated directly from Charles River. Only male rats were included in the experiments ...
-
No products found
because this supplier's products are not listed.
Xin Zhang, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... Viral titres were analysed by flow cytometry on cells stained with gp64-PE antibody (Expression Systems). Human GLP1R ...
-
No products found
because this supplier's products are not listed.
Klamann Linda, et al.,
bioRxiv - Plant Biology 2023
Quote:
... The concentration of chlorophyll a and b in the supernatant was measured using a spectrophotometer (Tecan, Männedorf, Switzerland) at 663 and 645 nm ...
-
No products found
because this supplier's products are not listed.
Elizabeth R. Sharlow, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 20 ng/mL glial cell derived neurotrophic factor (Shenandoah Biotechnology), 1 mM dibutyryl cyclic adenosine monophosphate (MilliporeSigma) ...
-
No products found
because this supplier's products are not listed.
Wilfred A. Jefferies, et al.,
bioRxiv - Immunology 2023
Quote:
... A B.1.617.2 (Delta) SARS-CoV-2 spike antibody (ACROBiosystems; S1N-S58A1) was used to set up a standard curve which was structured using Graphpad prism (Version 9.4.1 ...
-
No products found
because this supplier's products are not listed.
Karan H. Muchhala, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... Glial cell line-derived neurotrophic factor (GDNF) was purchased from Neuromics (Edina, MN). Poly-D-lysine was purchased from MiliporeSigma (Burlington ...
-
No products found
because this supplier's products are not listed.
Jeong Min Lee, et al.,
bioRxiv - Biochemistry 2024
Quote:
... supplemented with human Stem Cell Factor (SCF,100 ng/ml) (CellGenix, 1418-050), FMS-like Tyrosine Kinase 3 Ligand (Flt3L ...
-
No products found
because this supplier's products are not listed.
Kyle T. Shuler, et al.,
bioRxiv - Physiology 2020
Quote:
... 5 ng/ml basic-fibroblast growth factor (Progen, Heidleberg, Germany), and equal parts DMEM and Ham’s F10 mix ...
-
No products found
because this supplier's products are not listed.
Bing Han, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
No products found
because this supplier's products are not listed.
Tomoaki Sobajima, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 10 µM Aurora B inhibitor AZD1152 (ApexBio, A4112-APE-10mM), 25-100 nM PP1/PP2A inhibitor calyculin A (TOCRIS ...
-
No products found
because this supplier's products are not listed.
Aki Teranishi, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... with the primers 5’-GGGGAATTCGCCACCATGGGTTCTCA-3’ and 5’-CCC GCGGCCGCTCACTTCGCTGTCATCA-3’ was subcloned into EcoRI and NotI sites in the P B-CMV-MCS-EF1α-Puro PiggyBac transposon vector (PB510B-1, System Bioscience).
-
No products found
because this supplier's products are not listed.
Daisuke Oikawa, et al.,
bioRxiv - Cell Biology 2021
Quote:
... the parental and OTUD1-/--HEK293T cells (40,000 cells/well) or MEF cells (20,000 cells/well) were seeded in an E-Plate VIEW 16 (ACEA Biosciences, Inc.). The next day ...