-
No products found
because this supplier's products are not listed.
Jack Polmear, et al.,
bioRxiv - Immunology 2023
Quote:
96-well high-binding ELISA plates (Sarstedt) were coated overnight at 4°C with either goat anti-mouse IgA ...
-
No products found
because this supplier's products are not listed.
Michael T.S. Girling, et al.,
bioRxiv - Animal Behavior and Cognition 2024
Quote:
The MethylFlash Global DNA Methylation (5-mC) ELISA Easy Kit (Epigentek, USA), utilising a colourimetric assay ...
-
No products found
because this supplier's products are not listed.
Ezarul Faradianna Lokman, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Plasma was used for analyte analysis (Ghrelin, glucagon like peptide (GLP-1) and glucagon) using ELISA kit (Elabscience, China).
-
No products found
because this supplier's products are not listed.
Xiaoning Gao, et al.,
bioRxiv - Cell Biology 2024
Quote:
... ELISA kits from Solarbio, catalogue numbers SEKR-0002 ...
-
No products found
because this supplier's products are not listed.
Chenlu Zhang, et al.,
bioRxiv - Systems Biology 2024
Quote:
... Peptide and probe-peptide adduct were separated on Gemini C18 column (Phenomenex, 5 µm, 50 x 4.6 mm) at a flow rate of 1 mL/min ...
-
No products found
because this supplier's products are not listed.
Jiansheng Huang, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... MDA-HDL ELISA kit was purchased from Cell Biolabs Inc ...
-
No products found
because this supplier's products are not listed.
Geneviève Jolivet, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Anti Müllerian hormone levels were determined in 50 μl aliquots of serum samples by using an ELISA kit (AMH GenII ELISA, with AMH Gen II calibrators and controls, Beckman Coulter, Villepinte, France) as previously described (Bourdon et al ...
-
No products found
because this supplier's products are not listed.
Tayler D. Sheahan, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The following peptides were delivered in 5 µL of sterile saline: GRP (295 ng, Tocris 1789), Substance P (400 ng ...
-
No products found
because this supplier's products are not listed.
CF Almeida, et al.,
bioRxiv - Immunology 2021
Quote:
... the short guide RNAs (sgRNAs) targeting the signaling peptide (5’-GAGTAGCGCGAGCACAGCTA - 3’) was cloned into lentiCRISPR v2 (a gift from Feng Zhang; Addgene plasmid # 52961 ...
-
No products found
because this supplier's products are not listed.
Matthew G. Durrant, et al.,
bioRxiv - Genetics 2024
Quote:
... RNA was purified using RNA Clean & Concentrator - 5 kit and subsequently treated with RNA 5′ Polyphosphatase (Lucigen) for 30 minutes at 37°C ...
-
No products found
because this supplier's products are not listed.
Stefanie S. Schalm, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... was added to each well of a 384-well plate containing 1 μM Kemptide peptide substrate (5-FAM-LRRASLG; AnaSpec 2933), Km concentrations of ATP (5 μM ATP) ...
-
No products found
because this supplier's products are not listed.
Audrey Caron, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and the TNF-α mouse ELISA kit (Biomatik, EKA51917), respectively ...
-
No products found
because this supplier's products are not listed.
Yang Li, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... RANKL and insulin were measured by mouse Osteocalcin ELISA Kit (BioVision), OPG ELISA Kit (Boster Biological Technology) ...
-
No products found
because this supplier's products are not listed.
David Camerini, et al.,
bioRxiv - Immunology 2023
Quote:
... ELISA plates were coated overnight with rabbit anti human Fc gamma chain-specific antibody (Jackson ImmunoResearch). Plates were then washed with DPBS ...
-
Single well glass bottom plate with high performance #1.5 cover glass (0.170±0.005mm). Black...
Cat# P01-1.5H,
20/case, $249.00
Ask
Lissenya B. Argueta, et al.,
bioRxiv - Cell Biology 2021
Quote:
... hESC-qualified)-coated plates at 4×10^5/well in 24-well plates or 3×10^4/well in glass-like polymer bottom 96-well plates (CellVis).
-
No products found
because this supplier's products are not listed.
Kathleen Bates, Kim Le, Hang Lu,
bioRxiv - Bioengineering 2021
Quote:
... gravid day 1 adults animals were picked onto prepared palmitic acid plates and plates were imaged at 2 and 5 hours at 1.6x on a stereomicroscope (Leica M165 FC) using a 1.3 MP CMOS camera (Thorlabs DCC1645C ...
-
No products found
because this supplier's products are not listed.
Pedro de los Reyes, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and 5-µL of SensiFAST SYBR & Fluorescein Kit (Bioline). Each sample was measured in triplicate ...
-
No products found
because this supplier's products are not listed.
Qingwen Qian, et al.,
bioRxiv - Physiology 2022
Quote:
... were measured using commercially available ELISA kits (TSH ELISA kit, G-Biosciences, Cat No. IT6045; free T3 ELISA kit, G-Biosciences, Cat No. IT5691; T4 ELISA kit, G-Biosciences, Cat No ...
-
No products found
because this supplier's products are not listed.
Daisuke Ariyasu, et al.,
bioRxiv - Genetics 2019
Quote:
... and 0.5 x 106 cells seeded in DMEM with 10% FBS in a 24-well plate with 10 μM MG132 (Peptide Institute, Osaka, Japan), or DMSO ...
-
No products found
because this supplier's products are not listed.
Atsushi Sugimoto, et al.,
bioRxiv - Microbiology 2022
Quote:
ELISA Kit (41135-1, PBL Assay Science, USA) and the Human IL-29/IL-28B (IFNλ1/3 ...
-
No products found
because this supplier's products are not listed.
Koki Yoshimoto, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Human HGF Quantikine ELISA (R&D, DHG00B) and Human MMP-9 Sandwich ELISA Kit (Proteintech, KE00164) were used for cell culture supernatants according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Ana B. Romero-Losada, et al.,
bioRxiv - Plant Biology 2023
Quote:
... a standard (MS synthetic peptide calibration kit from Sciex) was injected to self-calibrate the equipment ...
-
No products found
because this supplier's products are not listed.
Kelsey Voss, et al.,
bioRxiv - Immunology 2021
Quote:
Autoantibodies were measured with ELISA kits purchased from Alpha Diagnostics: Anti-Histone Total Ig ...
-
No products found
because this supplier's products are not listed.
Emanuele Roscioli, et al.,
bioRxiv - Microbiology 2024
Quote:
... ELISA plates were coated with 2 µg/ml of goat anti-human IgG (Southern Biotech) at 4°C overnight ...
-
No products found
because this supplier's products are not listed.
Samantha C. Lauby, Patrick O. McGowan,
bioRxiv - Neuroscience 2020
Quote:
... was measured in the pup serum (n = 5-7 per group) using an ELISA (MP Biomedicals Inc., USA) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Lannah S. Abasi, et al.,
bioRxiv - Biophysics 2023
Quote:
... Samples (5 µL) were placed in a µ-Slide 18-well glass bottom multi-well plate (Ibidi) for imaging and were allowed to settle for 5-10 minutes ...
-
No products found
because this supplier's products are not listed.
Tao Qiu, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... total RNA from the cells plated on 96 well plates were first extracted and purified using the RNAprep Pure Micro Kit (TIANGEN). Reverse transcription was performed with HiScript III cDNA Synthesis Kit (Vazyme) ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Gururaj Shivange, et al.,
bioRxiv - Biochemistry 2021
Quote:
... For coating 96-well ELISA plates (Olympus), the protein solutions (2μg/ml ...
-
No products found
because this supplier's products are not listed.
Ziyi Zhang, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Add 100 μL Working Biotin Conjugate Antibody (Rat IL-6 ELISA Kit, RK00020; Rat IL-1β ELISA Kit, RK00009; Rat IL-10 ELISA Kit, RK00050, Abclonal, China) in each well ...
-
No products found
because this supplier's products are not listed.
Ross Peterson, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
A Sandwich ELISA (Bovine Lactoferrin ELISA kit, NBP3-12185, Novus Biologicals) was used and adopted to determine bovine lactoferrin concentrations in rat serum ...
-
No products found
because this supplier's products are not listed.
Hassan Nassour, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... The IP-One ELISA assay kit from CisBio Bioassays ...
-
No products found
because this supplier's products are not listed.
Jurre A. Steens, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and/or FAM-peptide substrate (5 μM) (Eurogentec AS-60579-01). Assays were incubated for one hour at 37C with a FAM channel measurement at 1 min intervals in a Thermo Scientific Quantstudio 1 RT-qPCR instrument running Quantstudio Design & Analysis software (v1.5.2) ...
-
No products found
because this supplier's products are not listed.
Laura C. Sommerfeld, et al.,
bioRxiv - Molecular Biology 2022
Quote:
Freshly isolated murine left atrial cardiac myocytes were plated on 10mm diameter laminin-coated coverslips (Mattek, 35 mm dish, 1.5# coverglass), fixed ...
-
No products found
because this supplier's products are not listed.
Alex W Chan, et al.,
bioRxiv - Microbiology 2023
Quote:
... Peptides were loaded onto a analytical column (column: PF360-75-15-N-5, New Objective, 360 µm OD ...
-
No products found
because this supplier's products are not listed.
Hongwen Chen, et al.,
bioRxiv - Biophysics 2023
Quote:
... and the complex was eluted with 5 CVs of 3×Flag peptide (0.1 mg/ml; ApexBio). The eluted protein was further purified by gel filtration using a Superose 6 Increase 10/300 GL column (Cytiva ...
-
No products found
because this supplier's products are not listed.
Alice Wedler, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Plates were analyzed 5 days post seeding using an Incucyte S3 (Sartorius). Additionally ...
-
No products found
because this supplier's products are not listed.
Tommy Weiss-Sadan, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Peptides were desalted with stage tips using the following procedure: Peptides were reconstituted with 5% acetonitrile/0.1 % formic acid and loaded onto Empore C18 disks (3M) packed into a 200 µl pipette tips pre-equilibrated with LC-MS grade methanol and water containing 0.1% formic acid ...
-
No products found
because this supplier's products are not listed.
John Lees, et al.,
bioRxiv - Molecular Biology 2023
Quote:
MeDIP-Seq libraries for Ion Torrent semiconductor sequencing were performed on the Ion Torrent PGM using a modified protocol from Ion Plus Fragment Library kit (Catalog # 4471252) combined with a 5-hydroxymethylcytosine (5hmC Kit, Catalog # AF-110–0016) immunoprecipitation kit (Diagenode) according to a previously optimized protocol (Guerrero-Bosagna & Jensen ...
-
No products found
because this supplier's products are not listed.
Henriette Andresen, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
125I-ANP was purchased from Phoenix Pharmaceuticals. NPs were obtained from GenScript and Sigma-Aldrich and proBNP from HyTest ...
-
No products found
because this supplier's products are not listed.
Haruo Ogawa, Masami Kodama, Kei Izumikawa,
bioRxiv - Biochemistry 2020
Quote:
... cDNA encoding rat ANP receptor (GenBank ID: NM_012613) was purchased from OriGene Technologies Inc ...
-
No products found
because this supplier's products are not listed.
Maria L. Sorkin, et al.,
bioRxiv - Plant Biology 2022
Quote:
... and 5 μM MG132 (Peptides International, Louisville, KY)) and sonicated using a duty cycle of 20 s (2 s on ...
-
No products found
because this supplier's products are not listed.
Rebecca S. Hofford, et al.,
bioRxiv - Neuroscience 2020
Quote:
A morphine ELISA kit (Abnova #KA0935) was used to quantify morphine in serum and DStr ...
-
No products found
because this supplier's products are not listed.
Anissa A. Widjaja, et al.,
bioRxiv - Molecular Biology 2023
Quote:
Primary mouse atrial fibroblasts (MAFs) were isolated from wild-type of B6.129S1-Il11ratm1Wehi/J mouse strain (The Jackson Laboratory). Mouse atria were minced and digested with mild agitation for 30 minutes at 37°C in DMEM containing 1% P/S and 0.14 Wunsch U ml-1 Liberase (5401119001 ...
-
No products found
because this supplier's products are not listed.
Brandon J. DeOre, et al.,
bioRxiv - Cell Biology 2020
Quote:
Commercial ELISA kits were purchased from Cytoskeleton (G-LISA) to quantify RhoA and Rac1 activation (Cytoskeleton) ...
-
No products found
because this supplier's products are not listed.
Maitreyi Rathod, et al.,
bioRxiv - Cell Biology 2023
Quote:
... samples were acidified with 5% TFA and peptides were purified using C18 reverse-phase spin columns (Macrospin, Harvard Apparatus) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Julian R. Smith, et al.,
bioRxiv - Immunology 2022
Quote:
H1 control AC16 cardiomyocytes and cGAS KO AC16s were seeded in 12-well plates and transfected with 5 mg of CT-DNA using Transit X2 (Mirus) at a 2:1 ratio for 8 h prior to harvest ...
-
Prepared to contain higher collagenase and caseinase activities. A dialyzed, lyophilized powder.
Cat# LS005282,
1 gm, $246.00
Ask
Surya D. Aggarwal, et al.,
bioRxiv - Microbiology 2022
Quote:
... Cultures were incubated statically at 37°C with 5% CO2 followed by plating on TSA plates supplemented with 100 µl of catalase (38,000 U/ml; Worthington Biochemical Corporation, NJ) and the desired antibiotic (250 µg/ml kanamycin or 200 µg/ml streptomycin) ...
-
No products found
because this supplier's products are not listed.
Simone Vormittag, et al.,
bioRxiv - Microbiology 2022
Quote:
... infected cells (including supernatant) were collected from the 6-wells plate, centrifuged (500× g, 5 min, RT) and fixed with 4% PFA (Electron Microscopy Sciences) for 30min at RT ...
-
No products found
because this supplier's products are not listed.
Diogo F.T. Veiga, et al.,
bioRxiv - Genomics 2020
Quote:
... non-unique-PacBio+Uniprot (peptides mapped to both PacBio and Uniprot proteins), and multigene (peptides mapped to multiple genes).