-
No products found
because this supplier's products are not listed.
Rocío del M. Saavedra-Peña, et al.,
bioRxiv - Physiology 2022
Quote:
... Cells were then stained with anti-BrdU antibody (Alexa Fluor 647; Phoenix Flow Systems; AX647) at 1:30 in HBSS with 3% BSA overnight in the dark at 4C ...
-
No products found
because this supplier's products are not listed.
Laura Frohn, et al.,
bioRxiv - Physiology 2023
Quote:
... Samples were then incubated with 100 µL of anti-rainbow-trout IgM monoclonal antibody (Aquatic Diagnostic Ltd. ...
-
No products found
because this supplier's products are not listed.
Minxiao Yang, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Primary antibodies used for co-staining were rabbit-anti-Gramd2 (1:100, ATLAS biological, CAS #HPA 029435), rabbit-anti-Sftpc (1:300 ...
-
No products found
because this supplier's products are not listed.
Tomozumi Imamichi, et al.,
bioRxiv - Microbiology 2022
Quote:
... and anti-protease antibody (Cat# ab211627 Abcam, Cat# SKU: 65-018, As One International, Santa Clara, CA, USA), Protein bands were detected by using the ECL Prime Western Blotting Detection Reagent (MiliporeSigma ...
-
No products found
because this supplier's products are not listed.
Anne Slavotinek, et al.,
bioRxiv - Genetics 2020
Quote:
... Neomycin phosphotransferase II (NPTII) expressed from NeoR cassette on pcDNA3-Exosc5 vectors was detected with anti-NPTII monoclonal antibody (1:1000; Cell Applications, Inc.). Primary antibodies were detected using goat secondary antibodies coupled to horseradish peroxidase (1:3000 ...
-
No products found
because this supplier's products are not listed.
Volha Liaudanskaya, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and Anti-Anti (1%) from Sciencell research laboratories (cat.no ...
-
No products found
because this supplier's products are not listed.
Tetsuro Yamamoto, et al.,
bioRxiv - Immunology 2023
Quote:
... HRP-human IgG antibody (EY Laboratories, USA), and BT IgE antibody (Bio-Rad Laboratories ...
-
No products found
because this supplier's products are not listed.
Giovannino Silvestri, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... anti-SET (Globozymes); anti-ABL (Ab-3) ...
-
No products found
because this supplier's products are not listed.
Takeshi Katsuda, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and 1× antibiotics (anti-anti (Thermo) or gentamycin (Gemini Bio-Products)) ...
-
No products found
because this supplier's products are not listed.
Sanne van der Niet, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Dihydrochloride) detection was performed using anti dinitrophenol (DNP) (Polyclonal Anti-DNP, Oxford Biomedical Research). All antibodies were diluted in 1% BSA in PBS ...
-
No products found
because this supplier's products are not listed.
Katrina Mekhail, et al.,
bioRxiv - Cell Biology 2022
Quote:
... anti-C9 agarose bead (Cube Biotech), HA antibody (Abcam ...
-
No products found
because this supplier's products are not listed.
Renee C. Geck, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Antibodies were used at indicated dilutions in 5% milk (Andwin Scientific) in TBST buffer (Boston Bioproducts) ...
-
No products found
because this supplier's products are not listed.
Adriana C. Camarano, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... rabbit anti-TH (1:1000; 657012, Calbiotech); chicken anti-TH (1:1000 ...
-
No products found
because this supplier's products are not listed.
Hongbing Zhang, et al.,
bioRxiv - Bioengineering 2020
Quote:
The E-ALPHA® human scFv antibody phage display libraries (Eureka Therapeutics) were used for the selection of human antibody constructs specific to SARS-CoV-2 spike protein ...
-
No products found
because this supplier's products are not listed.
Bálint András Barta, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... The antibodies were stained by incubation with 100μL of substrate solution (Neogen) containing 3,3′,5,5′-tetramethylbenzidine (TMB ...
-
No products found
because this supplier's products are not listed.
Mikayla A Payant, et al.,
bioRxiv - Neuroscience 2023
Quote:
... they were immediately incubated anti-rabbit MCH (1:2,000; RRID: AB_2314774) and anti-mouse NeuN (1:1,000; HB6429, Hello Bio, Princeton, NJ) in NDS overnight (RT) ...
-
No products found
because this supplier's products are not listed.
Jorge Mauricio Reyes-Ruiz, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Monoclonal antibodies were diluted in protein array blocking buffer (GVS, Sanford, ME, USA) to a final concentration of 5 ng/ml ...
-
No products found
because this supplier's products are not listed.
Ying Zhu, et al.,
bioRxiv - Systems Biology 2022
Quote:
... anti-TIMM23 (1:1000, mouse, DB Biotech, 611222). After washing 3 times with TBST ...
-
No products found
because this supplier's products are not listed.
Michael P. Motley, et al.,
bioRxiv - Immunology 2020
Quote:
Antibodies were produced weekly over six months from respective hybridomas grown in CELLine (Wheaton) flasks fed with High-Glucose DMEM + 10% NCTC media and 1x Penicillin-Streptomycin and 1x Non-Essential Amino Acids ...
-
No products found
because this supplier's products are not listed.
Lebogang N. Maruma, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Cell Signalling Technology antibodies and Promega luminometry kits were procured from Anatech (Johannesburg, South Africa). All other reagents were purchased from Merck (Darmstadt ...
-
No products found
because this supplier's products are not listed.
M Carmen Garza, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Sections were incubated with an L42 primary antibody (0.046 µg/ml; R-Biopharm, Darmstadt, Germany) at room temperature for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Steven G. Sayson, et al.,
bioRxiv - Immunology 2024
Quote:
... anti-Citrullinated Histone H3 (1:100; Abbomax, San Jose, California), or anti-Myeloperoxidase (1:100 ...
-
No products found
because this supplier's products are not listed.
Ragna S. Häussler, et al.,
bioRxiv - Biochemistry 2019
Quote:
... the antibody-coupled beads were washed three times in 100 μl 1x PBS (09-9400, Medicago), 0.05% Tween20 (BP337 ...
-
No products found
because this supplier's products are not listed.
Sameer Ahmed Bhat, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-phospho-cofilin-S3 (St Johns Laboratory, STJ90230; 1:2000 IB); anti-cofilin (CST ...
-
No products found
because this supplier's products are not listed.
Priyamvada Acharya, et al.,
bioRxiv - Immunology 2020
Quote:
... were captured using mouse anti-AVI-tag mAb (Avidity LLC, Aurora, CO). In brief ...
-
No products found
because this supplier's products are not listed.
István Fodor, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2) incubation with a rabbit anti-ap-GnRH/CRZ antiserum (#AS203-2, EZbiolab; antigen was a synthetic undecapeptide ...
-
No products found
because this supplier's products are not listed.
Alexander Scheiter, et al.,
bioRxiv - Pathology 2021
Quote:
A compound library including 315 approved anti-cancer drugs was purchased from TargetMol (L2110 ...
-
No products found
because this supplier's products are not listed.
Camilla S. Colding-Christensen, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... The following antibodies were raised against the indicated peptides derived from Xenopus laevis proteins (New England Peptide now Biosynth): Dbn1 (Ac-CWDSDPVMEEEEEEEEGGGFGESA-OH) ...
-
No products found
because this supplier's products are not listed.
Eun Hye Kim, et al.,
bioRxiv - Microbiology 2022
Quote:
... Cells were washed and stained with antibodies against cell surface molecules in PBS containing 4% of human serum (Valley Biomedical). NGFR was detected with a 20 μl per million cells of Alexa Flour 647 conjugated α-NGFR (BD Bioscience) ...
-
No products found
because this supplier's products are not listed.
Branislav Kovacech, et al.,
bioRxiv - Microbiology 2021
Quote:
... Binding of HRP-conjugated RBD to immobilized antibody 1 was detected with TMB one substrate (Kementec Solutions A/S, Demark) and stopped with 50 μl of 0.25 M H2SO4 ...
-
No products found
because this supplier's products are not listed.
Xuyong Chen, et al.,
bioRxiv - Immunology 2021
Quote:
... Antibodies were used for detecting the target methylation site (Table 2).Flow cytometry data were acquired on Novocyte (ACEA Biosciences) and were analyzed with FlowJo software (BD Biosciences).
-
No products found
because this supplier's products are not listed.
Tadayuki Komori, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Each cover glass was placed on a 35 μL spot of diluted primary antibody solution made on a sheet of parafilm (Bemis) so that the surface with cells present is facing the antibody solution45 ...
-
No products found
because this supplier's products are not listed.
Yeon-Jee Kahm, Uhee Jung, Rae-Kwon Kim,
bioRxiv - Cancer Biology 2023
Quote:
... cells were incubated with antibodies in a solution of Tris-buffered saline (cat. no. A0027, BIO BASIC, Markham ON, Canada) at 4°C for overnight ...
-
No products found
because this supplier's products are not listed.
Chenxi Li, et al.,
bioRxiv - Immunology 2024
Quote:
... Emissions from QDs and antibodies were separated by a beam splitter (T 580 lpxxr, Chroma Technology Corp, Bellows Falls, USA), then captured by two Rolera EM2 cameras and processed using VisiView software (Visitron Systems GmbH ...
-
No products found
because this supplier's products are not listed.
João L. Pereira, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Tris-buffered saline with 0.1% Tween 20 was used for washing and antibody incubation as well as membrane blocking with 5% bovine serum albumin (cat. no. MB04602, NZYTech). The chemiluminescent signals were acquired by incubating the membrane with SuperSignal West Femto Maximum Sensitivity Substrate (cat ...
-
No products found
because this supplier's products are not listed.
Lucy Ngo, et al.,
bioRxiv - Systems Biology 2019
Quote:
▪ Lint free cotton swab with anti-static handle (Puritan Medical Products, SKU#: 876-PPC)
-
No products found
because this supplier's products are not listed.
Irmgard U. Haussmann, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... a T7 promoter oligonucleotide (CCTGGCTAATACGACTCACTATAG) was annealed to an anti-sense Ultramer (IDT DNA) encoding the entire sgRNA in addition to the T7 promoter ...
-
No products found
because this supplier's products are not listed.
Grzegorz Maciag, et al.,
bioRxiv - Cell Biology 2024
Quote:
... After antibody staining the tissue was washed 6 times in PBS and before imaging the tissue was incubated in RapiClear (SUNJin Lab) for 30-60 minutes at room temperature ...
-
Cat# RBM7-30931TH,
25ug : USD $319
Ask
Yan Qi, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... the presence of anti- Ad and anti-hemagglutinin antibodies was measured by ELISA against a purified Ad6 virus preparation (Greffex, Inc.) and a recombinant hemagglutinin protein (Creative Biomart). In the first case ...
-
No products found
because this supplier's products are not listed.
Rodney M. Ritzel, et al.,
bioRxiv - Neuroscience 2022
Quote:
... sections were mounted onto glass slides with coverslips using an anti-fade Hydromount solution (National Diagnostics). The following primary and secondary antibodies were used ...
-
No products found
because this supplier's products are not listed.
Beatriz A. Osuna, et al.,
bioRxiv - Microbiology 2019
Quote:
... and 110 ng of anti-CRISPR expression plasmids with 1.25 µl of TransIT-X2 (Mirus Bio) in 20 µl Opti-MEM ...
-
No products found
because this supplier's products are not listed.
Machmouchi Dana, et al.,
bioRxiv - Microbiology 2024
Quote:
... ZIKV infectivity was assessed using the mouse anti-E protein mAb 4G2 (RD-Biotech, Besançon, France). Antibody donkey anti-mouse Alexa Fluor 488 IgG (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Ashok Pabbathi, et al.,
bioRxiv - Biophysics 2021
Quote:
... We washed out excess antibody with BRB80 and then incubated the flow channel with 1% Pluronic F-127 (PK-CA707-59000, PromoCell Inc., Heidelberg, Germany) for 5 min to passivate the surface ...
-
No products found
because this supplier's products are not listed.
Kourosh Kouhmareh, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The labeled HA plus a combination of biotinylated monoclonal antibodies was mixed at a 1:16 ratio into phosphate buffered saline (PBS, 1X Caisson Labs PBL01-500ML) along with 0.1% Tween-20. ...
-
No products found
because this supplier's products are not listed.
M Kouwenberg, et al.,
bioRxiv - Immunology 2020
Quote:
... To analyze DC maturation cells were stained with anti-CD11c (clone N418, IQ products, Groningen, the Netherlands), anti-CD40 (clone FGK45.5 ...
-
No products found
because this supplier's products are not listed.
Anh T. P. Ngo, et al.,
bioRxiv - Cell Biology 2023
Quote:
Thrombin anti-thrombin complexes in septic plasma were measured using commercially available ELISA kits (AssayPro; EMT1020-1) according to manufacturers’ instructions ...
-
No products found
because this supplier's products are not listed.
Raphael Trenker, et al.,
bioRxiv - Biochemistry 2024
Quote:
... Ligand-coated anti-Flag beads were serially 3x washed with Buffer A containing 0.5 mM DDM (Anatrace) and eluted with Buffer A containing 0.5 mM DDM and 250 µg/ml of Flag peptide (SinoBiological) ...
-
No products found
because this supplier's products are not listed.
Ankita Datey, et al.,
bioRxiv - Microbiology 2019
Quote:
The serum samples were also subjected to indirect ELISA to detect the presence of IgG antibodies against JEV using Porcine JE IgG ELISA Kit (Glory Science Co., Ltd, USA) in accordance with the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Chongkai Zhai, et al.,
bioRxiv - Microbiology 2021
Quote:
... The D-dimer and FDPs concentrations of serum samples were determined by the double antibody sandwich method using mouse D-dimer and mouse FDPs ELISA kits (Sunlong Biotech, Hangzhou, Zhejiang, China) as described previously [44] ...
-
No products found
because this supplier's products are not listed.
Mitsuhiro Abe, et al.,
bioRxiv - Cell Biology 2024
Quote:
... The cells were washed and incubated with HMSiR-coupled goat anti-rabbit IgG (#A204-01, GORYO Chemical, Inc.).