-
No products found
because this supplier's products are not listed.
Mathias Hutzler, et al.,
bioRxiv - Microbiology 2021
Quote:
... [U-14C]-maltotriose (ARC 627) was obtained from American Radiolabeled Chemicals (St. Louis, MO, USA) and re-purified before use as described by (Dietvorst et al. ...
-
No products found
because this supplier's products are not listed.
S. M. Nayeemul Bari, et al.,
bioRxiv - Microbiology 2021
Quote:
... The 10His-Smt3-tag was removed from most concentrated eluates using SUMO Protease (McLab, 1000 U) and supplied buffer (salt-free) ...
-
No products found
because this supplier's products are not listed.
Laura Di Patria, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and U-2 OS cell lines were originally obtained from ATCC (LGC Standards sarl, Molsheim, France). The human IOR/OS18 cell line was kindly provided by Pr M Serra (Istituti Ortopedici Rizzoli ...
-
No products found
because this supplier's products are not listed.
Lucas W. Hemmer, et al.,
bioRxiv - Genetics 2019
Quote:
... Single flies were placed into a U-bottom polypropylene 96-well plate with lysis buffer and 3.5 mm steel grinding balls (BioSpec) then homogenized with a MiniBeadBeater-96 at 2,100 rpm for 45 seconds ...
-
No products found
because this supplier's products are not listed.
Sahar Melamed, et al.,
bioRxiv - Microbiology 2023
Quote:
... After the addition of dNTPs (1 mM each) and AMV reverse transcriptase (10 U, Life Sciences Advanced Technologies Inc.), the reactions were incubated in a 10-μl reaction volume at 42°C for 1 h ...
-
No products found
because this supplier's products are not listed.
K. Tani, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Both native dimeric LH1-RC and monomeric ΔU LH1-RC were concentrated for absorption measurement and assessed by negative-stain EM using a JEM-1010 instrument (JEOL).
-
No products found
because this supplier's products are not listed.
Qi Qu, et al.,
bioRxiv - Physiology 2023
Quote:
... and the serum ratios of [U-13C]glucose to unlabelled glucose were determined using the ExionLC AD UPLC system (SCIEX) interfaced with a QTRAP 5500 MS (SCIEX) ...
-
No products found
because this supplier's products are not listed.
Maria N Barrachina, et al.,
bioRxiv - Cell Biology 2023
Quote:
... HSPCs were incubated in complete medium containing TPO (50 ng/mL) and recombinant hirudin (100 U/mL, Aniara Diagnostics, RE120A)) for 4 days.42 To assess proplatelet production ...
-
No products found
because this supplier's products are not listed.
Chi Xu, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and 1% proteinase inhibitor cocktail) with 160 U/mL RNase inhibitor and the nuclei were disrupted by sonication (Covaris S200). The sonicated samples were centrifuged at 13,800g for 5 minutes at 4°C to pellet debris ...
-
No products found
because this supplier's products are not listed.
Joana Saldida, et al.,
bioRxiv - Systems Biology 2020
Quote:
... The third set of cultures contained a mixture of 80% unlabelled and 20% uniformly labelled [U-13C] glucose (Buchem, CLM-1396). From each flask ...
-
No products found
because this supplier's products are not listed.
Olga Dal Monte, et al.,
bioRxiv - Neuroscience 2019
Quote:
LFP and spiking activity was recorded using 16-channel axial array electrodes (U-or V-Probes, Plexon) or single tungsten electrodes (FHC Instruments) placed in each of the recording regions using a 32-channel system (Plexon) ...
-
No products found
because this supplier's products are not listed.
Kevin H-C Wei, Kamalakar Chatla, Doris Bachtrog,
bioRxiv - Evolutionary Biology 2022
Quote:
... we prepared 10-50% sucrose gradients in polysome gradient buffer (250mM NaCl, 15mM MgCl2, 20 U/ml Superase ln, 20ug/ml Emetine) with a GradientMaster (Biocomp Instruments). Monosome fractions were then collected after resolving and fractionating the gradient ...
-
No products found
because this supplier's products are not listed.
Eric Vallabh Minikel, et al.,
bioRxiv - Neuroscience 2019
Quote:
... StageTips38 comprised of two punches of C18 material (Empore 66883-U) fitted into a 200 µL pipette tip using a 16 gauge needle with 90° blunt ends (Cadence Science 7938) and a PEEK tubing puncher (Idex 1567 ...
-
No products found
because this supplier's products are not listed.
Birthe Dorgau, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... pre-coated 96-well plates (U-bottom, Helena, 92697T) in mTeSR™1 supplemented with 10 μM Y-27632 ROCK inhibitor (Chemdea, CD0141). 200 μl of differentiation medium was added after 2 days and hereupon half of the differentiation medium was changed every 2 days until day 18 of differentiation as described in Dorgau et al ...
-
No products found
because this supplier's products are not listed.
Xiawei Zhang, et al.,
bioRxiv - Immunology 2024
Quote:
... mice were anaesthetized with isoflurane then treated intratracheally with 1.875 U/Kg (mice weight) of bleomycin sulphate (Apollo Scientific, Cat. No. BI3543) in 50 μL of PBS.
-
No products found
because this supplier's products are not listed.
Shengchen Lin, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 9 weeks old KP mice was injected with 50 µl of the virus mix (10 mM CaCl2, 1×107 VVC-U-Ad5CMVCre (from Carver College of Medicine) diluted in Opti-MEM) ...
-
No products found
because this supplier's products are not listed.
Wenhe Lin, et al.,
bioRxiv - Genomics 2023
Quote:
... We measured plasma oxidized LDL (oxLDL) concentrations (U/L) immunologically using a sandwich-style enzyme-linked immunoabsorbent assay (Mercodia Oxidized LDL ELISA; ALPCO Diagnostics). Lipoprotein size distributions were estimated as absorbance in large size particles minus absorbance in small size particles ...
-
No products found
because this supplier's products are not listed.
Tetsuro Yamamoto, et al.,
bioRxiv - Immunology 2023
Quote:
... HRP-human IgG antibody (EY Laboratories, USA), and BT IgE antibody (Bio-Rad Laboratories ...
-
No products found
because this supplier's products are not listed.
Kalle Kipper, Abbas Mansour, Arto Pulk,
bioRxiv - Molecular Biology 2022
Quote:
RNA granule preparations were diluted with RNA Granule buffer to an optical density A260 = 2 U/mL aliquots of the dilution deposited on glow-discharged Quantifoil grids (Quantifoil 1.2/1.3, 300 mesh copper) pre-coated with a continuous layer of 3 nm carbon ...
-
No products found
because this supplier's products are not listed.
Giovannino Silvestri, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... anti-SET (Globozymes); anti-ABL (Ab-3) ...
-
No products found
because this supplier's products are not listed.
Sanne van der Niet, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Dihydrochloride) detection was performed using anti dinitrophenol (DNP) (Polyclonal Anti-DNP, Oxford Biomedical Research). All antibodies were diluted in 1% BSA in PBS ...
-
No products found
because this supplier's products are not listed.
Katrina Mekhail, et al.,
bioRxiv - Cell Biology 2022
Quote:
... anti-C9 agarose bead (Cube Biotech), HA antibody (Abcam ...
-
No products found
because this supplier's products are not listed.
Renee C. Geck, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Antibodies were used at indicated dilutions in 5% milk (Andwin Scientific) in TBST buffer (Boston Bioproducts) ...
-
No products found
because this supplier's products are not listed.
Hongbing Zhang, et al.,
bioRxiv - Bioengineering 2020
Quote:
The E-ALPHA® human scFv antibody phage display libraries (Eureka Therapeutics) were used for the selection of human antibody constructs specific to SARS-CoV-2 spike protein ...
-
No products found
because this supplier's products are not listed.
Mikayla A Payant, et al.,
bioRxiv - Neuroscience 2023
Quote:
... they were immediately incubated anti-rabbit MCH (1:2,000; RRID: AB_2314774) and anti-mouse NeuN (1:1,000; HB6429, Hello Bio, Princeton, NJ) in NDS overnight (RT) ...
-
No products found
because this supplier's products are not listed.
Jorge Mauricio Reyes-Ruiz, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Monoclonal antibodies were diluted in protein array blocking buffer (GVS, Sanford, ME, USA) to a final concentration of 5 ng/ml ...
-
No products found
because this supplier's products are not listed.
Ying Zhu, et al.,
bioRxiv - Systems Biology 2022
Quote:
... anti-TIMM23 (1:1000, mouse, DB Biotech, 611222). After washing 3 times with TBST ...
-
No products found
because this supplier's products are not listed.
Lebogang N. Maruma, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Cell Signalling Technology antibodies and Promega luminometry kits were procured from Anatech (Johannesburg, South Africa). All other reagents were purchased from Merck (Darmstadt ...
-
No products found
because this supplier's products are not listed.
M Carmen Garza, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Sections were incubated with an L42 primary antibody (0.046 µg/ml; R-Biopharm, Darmstadt, Germany) at room temperature for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Steven G. Sayson, et al.,
bioRxiv - Immunology 2024
Quote:
... anti-Citrullinated Histone H3 (1:100; Abbomax, San Jose, California), or anti-Myeloperoxidase (1:100 ...
-
No products found
because this supplier's products are not listed.
Ragna S. Häussler, et al.,
bioRxiv - Biochemistry 2019
Quote:
... the antibody-coupled beads were washed three times in 100 μl 1x PBS (09-9400, Medicago), 0.05% Tween20 (BP337 ...
-
No products found
because this supplier's products are not listed.
Sameer Ahmed Bhat, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-phospho-cofilin-S3 (St Johns Laboratory, STJ90230; 1:2000 IB); anti-cofilin (CST ...
-
No products found
because this supplier's products are not listed.
Priyamvada Acharya, et al.,
bioRxiv - Immunology 2020
Quote:
... were captured using mouse anti-AVI-tag mAb (Avidity LLC, Aurora, CO). In brief ...
-
No products found
because this supplier's products are not listed.
István Fodor, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2) incubation with a rabbit anti-ap-GnRH/CRZ antiserum (#AS203-2, EZbiolab; antigen was a synthetic undecapeptide ...
-
No products found
because this supplier's products are not listed.
Alexander Scheiter, et al.,
bioRxiv - Pathology 2021
Quote:
A compound library including 315 approved anti-cancer drugs was purchased from TargetMol (L2110 ...
-
No products found
because this supplier's products are not listed.
Branislav Kovacech, et al.,
bioRxiv - Microbiology 2021
Quote:
... Binding of HRP-conjugated RBD to immobilized antibody 1 was detected with TMB one substrate (Kementec Solutions A/S, Demark) and stopped with 50 μl of 0.25 M H2SO4 ...
-
No products found
because this supplier's products are not listed.
Xuyong Chen, et al.,
bioRxiv - Immunology 2021
Quote:
... Antibodies were used for detecting the target methylation site (Table 2).Flow cytometry data were acquired on Novocyte (ACEA Biosciences) and were analyzed with FlowJo software (BD Biosciences).
-
No products found
because this supplier's products are not listed.
Tadayuki Komori, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Each cover glass was placed on a 35 μL spot of diluted primary antibody solution made on a sheet of parafilm (Bemis) so that the surface with cells present is facing the antibody solution45 ...
-
No products found
because this supplier's products are not listed.
Lucy Ngo, et al.,
bioRxiv - Systems Biology 2019
Quote:
▪ Lint free cotton swab with anti-static handle (Puritan Medical Products, SKU#: 876-PPC)
-
No products found
because this supplier's products are not listed.
Irmgard U. Haussmann, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... a T7 promoter oligonucleotide (CCTGGCTAATACGACTCACTATAG) was annealed to an anti-sense Ultramer (IDT DNA) encoding the entire sgRNA in addition to the T7 promoter ...
-
No products found
Yan Qi, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... the presence of anti- Ad and anti-hemagglutinin antibodies was measured by ELISA against a purified Ad6 virus preparation (Greffex, Inc.) and a recombinant hemagglutinin protein (Creative Biomart). In the first case ...
-
No products found
because this supplier's products are not listed.
Grzegorz Maciag, et al.,
bioRxiv - Cell Biology 2024
Quote:
... After antibody staining the tissue was washed 6 times in PBS and before imaging the tissue was incubated in RapiClear (SUNJin Lab) for 30-60 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Beatriz A. Osuna, et al.,
bioRxiv - Microbiology 2019
Quote:
... and 110 ng of anti-CRISPR expression plasmids with 1.25 µl of TransIT-X2 (Mirus Bio) in 20 µl Opti-MEM ...
-
No products found
because this supplier's products are not listed.
Machmouchi Dana, et al.,
bioRxiv - Microbiology 2024
Quote:
... ZIKV infectivity was assessed using the mouse anti-E protein mAb 4G2 (RD-Biotech, Besançon, France). Antibody donkey anti-mouse Alexa Fluor 488 IgG (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Kourosh Kouhmareh, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The labeled HA plus a combination of biotinylated monoclonal antibodies was mixed at a 1:16 ratio into phosphate buffered saline (PBS, 1X Caisson Labs PBL01-500ML) along with 0.1% Tween-20. ...
-
No products found
because this supplier's products are not listed.
M Kouwenberg, et al.,
bioRxiv - Immunology 2020
Quote:
... To analyze DC maturation cells were stained with anti-CD11c (clone N418, IQ products, Groningen, the Netherlands), anti-CD40 (clone FGK45.5 ...
-
No products found
because this supplier's products are not listed.
Anh T. P. Ngo, et al.,
bioRxiv - Cell Biology 2023
Quote:
Thrombin anti-thrombin complexes in septic plasma were measured using commercially available ELISA kits (AssayPro; EMT1020-1) according to manufacturers’ instructions ...
-
No products found
because this supplier's products are not listed.
Ankita Datey, et al.,
bioRxiv - Microbiology 2019
Quote:
The serum samples were also subjected to indirect ELISA to detect the presence of IgG antibodies against JEV using Porcine JE IgG ELISA Kit (Glory Science Co., Ltd, USA) in accordance with the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Chongkai Zhai, et al.,
bioRxiv - Microbiology 2021
Quote:
... The D-dimer and FDPs concentrations of serum samples were determined by the double antibody sandwich method using mouse D-dimer and mouse FDPs ELISA kits (Sunlong Biotech, Hangzhou, Zhejiang, China) as described previously [44] ...
-
No products found
because this supplier's products are not listed.
Mitsuhiro Abe, et al.,
bioRxiv - Cell Biology 2024
Quote:
... The cells were washed and incubated with HMSiR-coupled goat anti-rabbit IgG (#A204-01, GORYO Chemical, Inc.).