-
No products found
because this supplier's products are not listed.
Marie O. Pohl, et al.,
bioRxiv - Microbiology 2021
Quote:
... A mouse (#Ab00458-1.1) or rabbit (Ab00458-23.0) anti-dsRNA antibody (9D5; Lucerna-Chem) was used to stain for SARS-CoV-2 infected cells ...
-
No products found
because this supplier's products are not listed.
Yongle Chen, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... were pretreated by overnight incubation at 37°C with a 10 µL mixture of 5 ng/µL dodecyl-beta-D-maltoside (DDM, J&K Scientific, China) and 1 ng/µL trypsin (Promega ...
-
No products found
because this supplier's products are not listed.
Rocío del M. Saavedra-Peña, et al.,
bioRxiv - Physiology 2022
Quote:
... Cells were then stained with anti-BrdU antibody (Alexa Fluor 647; Phoenix Flow Systems; AX647) at 1:30 in HBSS with 3% BSA overnight in the dark at 4C ...
-
No products found
because this supplier's products are not listed.
Dara Bree, et al.,
bioRxiv - Neuroscience 2019
Quote:
... a 96-well plate was coated with a mouse anti-CGRP capture antibody (Bertin Bioreagent) and incubated overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Laura Frohn, et al.,
bioRxiv - Physiology 2023
Quote:
... Samples were then incubated with 100 µL of anti-rainbow-trout IgM monoclonal antibody (Aquatic Diagnostic Ltd. ...
-
No products found
because this supplier's products are not listed.
Minxiao Yang, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Primary antibodies used for co-staining were rabbit-anti-Gramd2 (1:100, ATLAS biological, CAS #HPA 029435), rabbit-anti-Sftpc (1:300 ...
-
No products found
because this supplier's products are not listed.
Tomozumi Imamichi, et al.,
bioRxiv - Microbiology 2022
Quote:
... and anti-protease antibody (Cat# ab211627 Abcam, Cat# SKU: 65-018, As One International, Santa Clara, CA, USA), Protein bands were detected by using the ECL Prime Western Blotting Detection Reagent (MiliporeSigma ...
-
No products found
because this supplier's products are not listed.
Jasmine Alexander-Floyd, et al.,
bioRxiv - Immunology 2021
Quote:
... supernatants and recombinant cytokine standards were applied to anti-IL-1β antibody-coated (eBioscience) Immulon ELISA plates (ImmunoChemistry Technologies). IL-1β was detected using biotinylated anti IL-1β (eBioscience ...
-
No products found
because this supplier's products are not listed.
Sylvain Perriot, et al.,
bioRxiv - Immunology 2024
Quote:
... transfected Jurkat cells and co-culture with HLA-unenhanced neurons or in presence of a blocking anti-HLA ABC antibody (W6/32, AffinityImmuno). Luminescence was measured with a Multimode Microplate Reader (BioTek Synergy) ...
-
No products found
because this supplier's products are not listed.
Anne Slavotinek, et al.,
bioRxiv - Genetics 2020
Quote:
... Neomycin phosphotransferase II (NPTII) expressed from NeoR cassette on pcDNA3-Exosc5 vectors was detected with anti-NPTII monoclonal antibody (1:1000; Cell Applications, Inc.). Primary antibodies were detected using goat secondary antibodies coupled to horseradish peroxidase (1:3000 ...
-
No products found
because this supplier's products are not listed.
Volha Liaudanskaya, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and Anti-Anti (1%) from Sciencell research laboratories (cat.no ...
-
No products found
because this supplier's products are not listed.
Tetsuro Yamamoto, et al.,
bioRxiv - Immunology 2023
Quote:
... HRP-human IgG antibody (EY Laboratories, USA), and BT IgE antibody (Bio-Rad Laboratories ...
-
No products found
because this supplier's products are not listed.
Giovannino Silvestri, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... anti-SET (Globozymes); anti-ABL (Ab-3) ...
-
No products found
because this supplier's products are not listed.
Takeshi Katsuda, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and 1× antibiotics (anti-anti (Thermo) or gentamycin (Gemini Bio-Products)) ...
-
No products found
because this supplier's products are not listed.
Sanne van der Niet, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Dihydrochloride) detection was performed using anti dinitrophenol (DNP) (Polyclonal Anti-DNP, Oxford Biomedical Research). All antibodies were diluted in 1% BSA in PBS ...
-
No products found
because this supplier's products are not listed.
Renee C. Geck, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Antibodies were used at indicated dilutions in 5% milk (Andwin Scientific) in TBST buffer (Boston Bioproducts) ...
-
No products found
because this supplier's products are not listed.
Hongbing Zhang, et al.,
bioRxiv - Bioengineering 2020
Quote:
The E-ALPHA® human scFv antibody phage display libraries (Eureka Therapeutics) were used for the selection of human antibody constructs specific to SARS-CoV-2 spike protein ...
-
No products found
because this supplier's products are not listed.
Bálint András Barta, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... The antibodies were stained by incubation with 100μL of substrate solution (Neogen) containing 3,3′,5,5′-tetramethylbenzidine (TMB ...
-
No products found
because this supplier's products are not listed.
Andrew Wishart, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... inhibitory antibody or drug and plated on glass-bottomed dishes (MatTek, Ashland, MA) coated with 20μg/ml ECM protein and allowed to adhere for 2 hours ...
-
No products found
because this supplier's products are not listed.
Jorge Mauricio Reyes-Ruiz, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Monoclonal antibodies were diluted in protein array blocking buffer (GVS, Sanford, ME, USA) to a final concentration of 5 ng/ml ...
-
No products found
because this supplier's products are not listed.
Ying Zhu, et al.,
bioRxiv - Systems Biology 2022
Quote:
... anti-TIMM23 (1:1000, mouse, DB Biotech, 611222). After washing 3 times with TBST ...
-
No products found
because this supplier's products are not listed.
Li-Chun Cheng, et al.,
bioRxiv - Cell Biology 2023
Quote:
... rabbit anti-nesprin-3 (United States Biological Corporation), rabbit anti-myosin heavy chain (Abcam #124205) ...
-
No products found
because this supplier's products are not listed.
Michael P. Motley, et al.,
bioRxiv - Immunology 2020
Quote:
Antibodies were produced weekly over six months from respective hybridomas grown in CELLine (Wheaton) flasks fed with High-Glucose DMEM + 10% NCTC media and 1x Penicillin-Streptomycin and 1x Non-Essential Amino Acids ...
-
No products found
because this supplier's products are not listed.
Lebogang N. Maruma, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Cell Signalling Technology antibodies and Promega luminometry kits were procured from Anatech (Johannesburg, South Africa). All other reagents were purchased from Merck (Darmstadt ...
-
No products found
because this supplier's products are not listed.
Sameer Ahmed Bhat, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-phospho-cofilin-S3 (St Johns Laboratory, STJ90230; 1:2000 IB); anti-cofilin (CST ...
-
No products found
because this supplier's products are not listed.
Rosalie Martel, et al.,
bioRxiv - Bioengineering 2022
Quote:
Antibody microarrays were patterned on PolyAn 2D-Aldehyde slides (PolyAn) using the sciFLEXARRAYER SX inkjet bioprinter (Scienion). Slide were imaged in the 532 nm channel at 100% gain prior to patterning to qualitatively assess the uniformity of the aldehyde functionalization ...
-
A partially purified, lyophilized powder.
Cat# LS004093,
Bulk, Inquire
Ask
Markus Terrey, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Immunofluorescence with antibodies to BrdU was performed on sections treated with DNase I (5mU/µl, Worthington, LS002139) for 45 minutes at 37°C after antigen retrieval ...
-
No products found
because this supplier's products are not listed.
Filippo Bianchini, et al.,
bioRxiv - Immunology 2022
Quote:
... Fluorescent labeling of monoclonal antibodies was performed with the DY-647P1-NHS-ester reagent (Dyomics, Ref#647P1-01) according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
István Fodor, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2) incubation with a rabbit anti-ap-GnRH/CRZ antiserum (#AS203-2, EZbiolab; antigen was a synthetic undecapeptide ...
-
No products found
because this supplier's products are not listed.
Sebastian Fiedler, et al.,
bioRxiv - Biochemistry 2020
Quote:
Anti-SARS-CoV-2 seropositive human serum samples (convalescent) were obtained from BioIVT. BioIVT sought informed consent from each subject ...
-
No products found
because this supplier's products are not listed.
Alexander Scheiter, et al.,
bioRxiv - Pathology 2021
Quote:
A compound library including 315 approved anti-cancer drugs was purchased from TargetMol (L2110 ...
-
No products found
because this supplier's products are not listed.
Jayne E. Wiarda, et al.,
bioRxiv - Immunology 2022
Quote:
... mouse α-pig γδTCR-iFluor594 (primary antibody Washington State University PG2032; custom conjugation to iFluor594 performed by Caprico Biotechnologies); mouse α-pig CD4-PerCP-Cy5.5 (BD 561474) ...
-
No products found
because this supplier's products are not listed.
Renata Varnaitė, et al.,
bioRxiv - Immunology 2020
Quote:
... SARS-CoV-2 specific IgM antibodies were detected using EDI Novel Coronavirus COVID-19 IgM ELISA kit (Epitope Diagnostics), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Branislav Kovacech, et al.,
bioRxiv - Microbiology 2021
Quote:
... Binding of HRP-conjugated RBD to immobilized antibody 1 was detected with TMB one substrate (Kementec Solutions A/S, Demark) and stopped with 50 μl of 0.25 M H2SO4 ...
-
No products found
because this supplier's products are not listed.
Xuyong Chen, et al.,
bioRxiv - Immunology 2021
Quote:
... Antibodies were used for detecting the target methylation site (Table 2).Flow cytometry data were acquired on Novocyte (ACEA Biosciences) and were analyzed with FlowJo software (BD Biosciences).
-
No products found
because this supplier's products are not listed.
Tadayuki Komori, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Each cover glass was placed on a 35 μL spot of diluted primary antibody solution made on a sheet of parafilm (Bemis) so that the surface with cells present is facing the antibody solution45 ...
-
No products found
because this supplier's products are not listed.
Yeon-Jee Kahm, Uhee Jung, Rae-Kwon Kim,
bioRxiv - Cancer Biology 2023
Quote:
... cells were incubated with antibodies in a solution of Tris-buffered saline (cat. no. A0027, BIO BASIC, Markham ON, Canada) at 4°C for overnight ...
-
No products found
because this supplier's products are not listed.
Esther B. Florsheim, et al.,
bioRxiv - Immunology 2023
Quote:
... Capture antibodies were the same as for total IgE assay and 8 mg/mL of biotinylated OVA (OVA1-BN-1, Nanocs) was used for detection ...
-
No products found
because this supplier's products are not listed.
João L. Pereira, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Tris-buffered saline with 0.1% Tween 20 was used for washing and antibody incubation as well as membrane blocking with 5% bovine serum albumin (cat. no. MB04602, NZYTech). The chemiluminescent signals were acquired by incubating the membrane with SuperSignal West Femto Maximum Sensitivity Substrate (cat ...
-
No products found
because this supplier's products are not listed.
Irmgard U. Haussmann, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... a T7 promoter oligonucleotide (CCTGGCTAATACGACTCACTATAG) was annealed to an anti-sense Ultramer (IDT DNA) encoding the entire sgRNA in addition to the T7 promoter ...
-
No products found
because this supplier's products are not listed.
Zhengtang Qi, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... The membrane was blocked for 1 h at room temperature followed by incubation overnight at 4°C with primary antibodies including FAM132b (AVISCERA BIOSCIENCE), PI3K ...
-
No products found
Yan Qi, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... the presence of anti- Ad and anti-hemagglutinin antibodies was measured by ELISA against a purified Ad6 virus preparation (Greffex, Inc.) and a recombinant hemagglutinin protein (Creative Biomart). In the first case ...
-
No products found
because this supplier's products are not listed.
Grzegorz Maciag, et al.,
bioRxiv - Cell Biology 2024
Quote:
... After antibody staining the tissue was washed 6 times in PBS and before imaging the tissue was incubated in RapiClear (SUNJin Lab) for 30-60 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Susan E. Maloney, et al.,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
... each animal was given 0.25 mg of the chewable anti-inflammatory Rimadyl (Bio-Serv, Flemington, NJ) and the surgical area was shaved ...
-
No products found
because this supplier's products are not listed.
Kourosh Kouhmareh, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The labeled HA plus a combination of biotinylated monoclonal antibodies was mixed at a 1:16 ratio into phosphate buffered saline (PBS, 1X Caisson Labs PBL01-500ML) along with 0.1% Tween-20. ...
-
No products found
because this supplier's products are not listed.
M Kouwenberg, et al.,
bioRxiv - Immunology 2020
Quote:
... To analyze DC maturation cells were stained with anti-CD11c (clone N418, IQ products, Groningen, the Netherlands), anti-CD40 (clone FGK45.5 ...
-
No products found
because this supplier's products are not listed.
Anh T. P. Ngo, et al.,
bioRxiv - Cell Biology 2023
Quote:
Thrombin anti-thrombin complexes in septic plasma were measured using commercially available ELISA kits (AssayPro; EMT1020-1) according to manufacturers’ instructions ...
-
No products found
because this supplier's products are not listed.
Chongkai Zhai, et al.,
bioRxiv - Microbiology 2021
Quote:
... The D-dimer and FDPs concentrations of serum samples were determined by the double antibody sandwich method using mouse D-dimer and mouse FDPs ELISA kits (Sunlong Biotech, Hangzhou, Zhejiang, China) as described previously [44] ...
-
No products found
because this supplier's products are not listed.
Thomas T. Thomsen, et al.,
bioRxiv - Microbiology 2021
Quote:
... ∼200 µL blood from the jaw/cheek was collected in Eppendorf tubes with anti-coagulate (Sarstedt, Nümbrecht, Germany). Peritoneal lavage was performed by injecting 2.0 ml of sterile physiological saline IP ...
-
No products found
because this supplier's products are not listed.
Mitsuhiro Abe, et al.,
bioRxiv - Cell Biology 2024
Quote:
... The cells were washed and incubated with HMSiR-coupled goat anti-rabbit IgG (#A204-01, GORYO Chemical, Inc.).