-
No products found
because this supplier's products are not listed.
Christopher Cyrus Kuhn, et al.,
bioRxiv - Cell Biology 2022
Quote:
S protein (Cube Biotech #28703) and isolated platelets were mixed at final concentrations of 0.2 μg/ml ...
-
No products found
because this supplier's products are not listed.
Carlos A. Rico, et al.,
bioRxiv - Biophysics 2019
Quote:
... The labeled protein was recovered on an S-2000 column (Phenomenex Biosep-SEC-S-2000) equilibrated in 50% MeOH and its mass confirmed by ESI-MS (PSC ...
-
No products found
because this supplier's products are not listed.
Sebastian Pfeilmeier, et al.,
bioRxiv - Plant Biology 2023
Quote:
... 0.1% Azo-Xyloglucan (Megazyme, S-AZXG) or 0.1% polygalacturonic acid in 1M sodium phosphate buffer pH 7.0 (PGA ...
-
No products found
because this supplier's products are not listed.
Toshiyuki Ueki, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... and the HA Tag Polyclonal Antibody as primary antibodies and an anti-mouse IgG-gold (40 nm) antibody (40 nm Goat Anti-Mouse IgG gold conjugate, Expedeon) and the anti-rabbit IgG-gold (10 nm ...
-
No products found
because this supplier's products are not listed.
Priya Katyal, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Anti-Atsttrin antibody was supplied by Lampire Biological Laboratories (Pipersville ...
-
No products found
because this supplier's products are not listed.
Lei Liu, et al.,
bioRxiv - Immunology 2022
Quote:
... The following antibodies were used: anti-CD11b (Biogems, CA), anti-F4/80 (Biolegend ...
-
No products found
because this supplier's products are not listed.
Luca Carta, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... The membrane was stained with Ponceau S Stain (Boston BioProducts) to verify uniform protein loading ...
-
No products found
because this supplier's products are not listed.
Serap Sezen, et al.,
bioRxiv - Cancer Biology 2024
Quote:
Penicillin/Streptomycin (P/S) (PAN BIOTECH™ GmbH, Aidenbach, Germany)
-
No products found
because this supplier's products are not listed.
Annu Nummi, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Secondary antibody was an HRP-polymer anti-rabbit antibody (BiositeHisto Nordic Biosite cat. no KDB-Z47C3W). Immunoreactivity of antibodies was controlled in sections of porcine kidney ...
-
No products found
because this supplier's products are not listed.
Hyungsup Kim, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Mouse polyclonal anti-ANO9 antibody (1:100, AbFrontier, South Korea), monoclonal anti-c-Fos antibody (1:1000 ...
-
Chromatographically purified according to Drapeau et.al, J. Biol. Chem., 247, 6720 (1972)....
Cat# LS02126,
5x10 ug, $192.00
Ask
Ana Curinha, et al.,
bioRxiv - Cell Biology 2024
Quote:
... After enzymatic digestion (DMEM GlutaMAX, 1% P/S, 3% papain [Worthington 3126] ...
-
No products found
because this supplier's products are not listed.
Drishya Kurup, et al.,
bioRxiv - Microbiology 2020
Quote:
The following antibodies were used in this study: Anti-ZIKV-E mouse monoclonal antibody (Biofront Technologies, 1176-56), Pan-Flavivirus-E 4G2 mouse monoclonal antibody produced from hybridoma cell line D1-4G2-4-15 (ATCC ...
-
No products found
because this supplier's products are not listed.
Elsa Mazari-Arrighi, et al.,
bioRxiv - Bioengineering 2021
Quote:
... rabbit anti-rat albumin antibody (RaRa/ALB/7S, Nordic-MUbio, Netherlands) was used as primary antibody and biotinylated goat anti-rabbit antibody (VECTASTAIN Elite ABC HRP Kit ...
-
No products found
because this supplier's products are not listed.
Bradley M. Roberts, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Primary antibodies: rabbit anti-NeuN (1:500, Biosensis, R-3770–100). Sections were then incubated in species-appropriate fluorescent secondary antibodies with minimal cross-reactivity for 2 hours in PBS-Tx with 2% NDS at room temperature ...
-
No products found
because this supplier's products are not listed.
Glennis A. Logsdon, et al.,
bioRxiv - Genomics 2020
Quote:
... and then incubated with a mouse monoclonal anti-CENP-A antibody (1:200, Enzo, ADI-KAM-CC006-E) and rabbit monoclonal anti-5-methylcytosine antibody (1:200, RevMAb, RM231) for 3 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Christopher M. Jernigan, et al.,
bioRxiv - Neuroscience 2019
Quote:
Affinity-purified goat polyclonal anti-AmOA1 antibodies (21st Century Biochemicals, Inc. Marlborough, MA) were raised against a synthetic peptide acetyl-AMRNDRSPSYSMQVPQQGC-amide ...
-
No products found
because this supplier's products are not listed.
Ludmila Recoules, et al.,
bioRxiv - Genomics 2021
Quote:
... Rabbit anti- mH2A1.1 antibody was generated according to immunization protocol from Agro-Bio - La fierté Saint-Aubin – France ...
-
Anti-CTSS / Cathepsin S (Fsn0503h) is an antagonistic monoclonal antibody targeting cathepsin S....
Cat# A2629, SKU# A2629-1mg,
1mg, $539.00
Ask
Lindsay Piraino, et al.,
bioRxiv - Bioengineering 2023
Quote:
... The screen’s 25 top drug hits (Table S.4) were purchased from Selleck Chemicals for dose-response studies and prepared and stored per manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Swayam Prakash Srivastava, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Amplified vector DNA (Cloned 3’UTR human Angptl4 (Endofectin GeneCopoeia catalog no. EF013-S) and miRNA 3’UTR (MmiT088761-MT06-264ng/ul ...
-
No products found
because this supplier's products are not listed.
Swapneeta S. Date, et al.,
bioRxiv - Cell Biology 2021
Quote:
... VU101: Anti-ubiquitin Antibody (VU-0101, 1:1000) was purchased from LifeSensors (PA, USA). Anti-mouse HRP conjugate (W4021 ...
-
No products found
because this supplier's products are not listed.
R Barbieri, et al.,
bioRxiv - Microbiology 2020
Quote:
... the paraffin sections were incubated with anti-glycophorin A antibody JC 159 (Mouse Monoclonal Antibody, ref: Mob 066-05, Diagnostic BioSystems, Nanterre, France) at a 1/500 dilution using a Ventana Benchmark autostainer (Ventana Medical Systems ...
-
No products found
because this supplier's products are not listed.
Ayse Koca Caydasi, et al.,
bioRxiv - Cell Biology 2020
Quote:
For time-lapse experiment,s cells were adhered on glass-bottom dishes (MatTek, Ashland, MA) using 6% concanavalin A-Type IV (Sigma) ...
-
No products found
because this supplier's products are not listed.
Swastik Phulera, et al.,
bioRxiv - Biophysics 2024
Quote:
... The virus titer was determined by gp64-PE mouse anti-baculovirus antibody (Expression Systems, CA) using a Guava benchtop Flow Cytometer (Millipore ...
-
No products found
because this supplier's products are not listed.
Jason Small, Alison Weiss,
bioRxiv - Microbiology 2021
Quote:
... Cells were washed with PBST and placed in primary antibody (Rabbit Anti-E. coli, cat. 1001, ViroStat, Rabbit Anti-Intimin ...
-
No products found
because this supplier's products are not listed.
Xinglei Liu, Lu Rao, Arne Gennerich,
bioRxiv - Biophysics 2020
Quote:
... and incubated on ice with anti-GFP antibody Fab fragment-coated ∼1-μm diameter beads (980 nm, carboxyl-modified polystyrene microspheres, Bangs Laboratories) for 10 minutes ...
-
No products found
because this supplier's products are not listed.
Élora Midavaine, et al.,
bioRxiv - Neuroscience 2023
Quote:
... using 0.22 mmol/g Tentagel S RAM resin S (Rapp Polymere). Coupling of Fmoc amino acids or palmitic acid (ChemImpex International #35152 ...
-
No products found
because this supplier's products are not listed.
Drake M. Mellott, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Recombinant proteases were obtained from the following vendors: human cathepsin L (Millipore Sigma, Athens Research and Technology, Inc., (Texas A&M) or R&D Systems (UCSD) ...
-
No products found
because this supplier's products are not listed.
Branislav Kovacech, et al.,
bioRxiv - Microbiology 2021
Quote:
... Binding of HRP-conjugated RBD to immobilized antibody 1 was detected with TMB one substrate (Kementec Solutions A/S, Demark) and stopped with 50 μl of 0.25 M H2SO4 ...
-
No products found
because this supplier's products are not listed.
Paulina Kaplonek, et al.,
bioRxiv - Immunology 2021
Quote:
... hCoV-HKU1 spike protein (S) (Immune Tech), SARS-CoV-1 ...
-
No products found
because this supplier's products are not listed.
Maxwell Blazon, et al.,
bioRxiv - Neuroscience 2020
Quote:
... on an orbital rocker (SK-O180-S, Scilogex). To identify cell bodies ...
-
No products found
because this supplier's products are not listed.
Amir Pandi, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... TentaGel S RAM resin from Iris Biotech (Germany); Fmoc-L- Ala-OH-OH ...
-
No products found
because this supplier's products are not listed.
Patricia C. Lopes, Robert de Bruijn,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... Tissue homogenization was done by agitating the tubes for 20□s at a 7□m□s−□1 speed (Beadbug 6 homogenizer, Benchmark Scientific), followed by a 5□min rest period ...
-
No products found
because this supplier's products are not listed.
Kosuke Iwai, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... S-1811 and SU-8 Developer from Microchem (Newton, MA), gold-coated glass substrates and chromium-coated glass substrates from Telic (Valencia ...
-
No products found
because this supplier's products are not listed.
Ella N Hartenian, Britt A Glaunsinger,
bioRxiv - Microbiology 2019
Quote:
... or anti-ORF59 antibody (Advanced Biotechnologies 13-211-100 at 1:200) in 5% BSA overnight at 4 °C ...
-
No products found
because this supplier's products are not listed.
Martin F. Orth, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... monoclonal mouse anti-PD-1 antibody (1:80; 315M-96, MEDAC, Wedel, Germany), and monoclonal mouse anti-Ki-67 antibody (M7240 ...
-
No products found
because this supplier's products are not listed.
Julia Ramon Mateu, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... specimens were incubated in anti-phospho histone H3 antibody (ARG51679, Arigo Biolaboratories, Taiwan) diluted 1:150 in 5% NGS overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Markus Brandhofer, et al.,
bioRxiv - Immunology 2022
Quote:
... “hot region” from 0.5 t 1.5 s) using the MO.AffinityAnalysis V2.3 software (NanoTemper Technologies). Curve fitting for data presentation was performed by GraphPad Prism Version 6.07 (‘one site – total binding’).
-
No products found
because this supplier's products are not listed.
You Wu, Tam L. Ngyuen, Carrie E. Perlman,
bioRxiv - Physiology 2020
Quote:
... apply a vascular clamp (S&T B1-V, Fine Science Tools, Foster City, CA) between the right middle and caudal lobes and separate the caudal lobe distal to the clamp ...
-
No products found
because this supplier's products are not listed.
Jérémy Signoret-Genest, et al.,
bioRxiv - Neuroscience 2022
Quote:
... a 1-s footshock (0.9 mA; Model 2100 Isolated Pulse Stimulator, A-M System) immediately followed the last white noise burst ...
-
No products found
because this supplier's products are not listed.
Kristine Farmen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The primary antibody used was pneumococcal serotype 4 anti-capsule (SSI Diagnostica, 1:250), secondary antibody used was Alexa Fluor 620 (1:1000) ...
-
No products found
because this supplier's products are not listed.
Jessica Eira, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Incubation of the secondary antibodies donkey anti mouse Alexa Fluor 568 (1:1000, Alfagene, A10037) and donkey anti rabbit Alexa Fluor 647 (1:500 ...
-
No products found
because this supplier's products are not listed.
Xi Chen, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Liver slides were stained with goat-anti-hFIX antibody (1:2000, Affinity Biologicals, GAFIX-AP). Subsequently ...
-
No products found
because this supplier's products are not listed.
NC Rodgers, et al.,
bioRxiv - Cell Biology 2022
Quote:
... for 1 h and incubated overnight with primary antibodies: anti-rat CLASP1 (KT 67, Absea), anti-rat CLASP2 (KT69 ...
-
No products found
because this supplier's products are not listed.
Sandeep Surendra Panikar, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The purified mAbs was then reacted with a 20-fold molar excess of 2-S-(4-Isothiocyanatobenzyl)-1,4,7-triazacyclononane-1,4,7-triacetic acid (p-SCN-Bn-NOTA, Macrocyclics) overnight at 4 °C with gentle agitation ...
-
No products found
because this supplier's products are not listed.
Francesca Pischedda, et al.,
bioRxiv - Neuroscience 2020
Quote:
Affinity-purified anti-P-Thr645-NSF polyclonal antibody was made in a NZW female rabbit (Envigo) by immunization against a single peptide (amino acids 631–656 ...
-
No products found
because this supplier's products are not listed.
Lanlan Bai, et al.,
bioRxiv - Microbiology 2019
Quote:
... the cells were incubated with a primary anti-Env monoclonal antibody (Mab, BLV-1; VMRD, Pullman, WA) followed by incubation with Alexa Fluor 594 goat anti-mouse IgG (Invitrogen) ...
-
No products found
because this supplier's products are not listed.
Haiyang Feng, et al.,
bioRxiv - Genomics 2022
Quote:
... needles were beveled for 15 s at a 20° angle using a BV-10 Micropipette Beveler (Sutter Instruments). A holding pipette made from 1.0 mm borosilicate capillary with an open size of ~140 μm was used to hold the corona of the neonate ...
-
No products found
because this supplier's products are not listed.
David B. Kastner, et al.,
bioRxiv - Neuroscience 2024
Quote:
... a single guide RNA targeting the sequence GTGAAATCCAACCAATTCCA sequence within exon 5 of Scn2a was mixed with Cas9 (S. pyogenes) protein (QB3 MacroLab, UC Berkeley) and injected into the pronucleus of fertilized Long Evans (Crl:LE, Charles River Laboratories) embryos ...
-
No products found
because this supplier's products are not listed.
Júlia Vallvé-Juanico, et al.,
bioRxiv - Immunology 2022
Quote:
... the antibodies were resuspended with Antibody Stabilizer (Boca Scientific, Dedham, MA, USA) at a concentration of 0.2 mg/ml and stored at 4°C ...
-
No products found
because this supplier's products are not listed.
Yun Jin Chae, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Tissue samples were incubated for 3 h at RT with the primary antibody (anti-CD8 alpha) before visualization with the Polink-2 HRP Plus Broad DAB Detection System for Immunohistochemistry kit (GBI Labs, Bothell, WA) according to the manufacturer’s instructions ...