-
No products found
because this supplier's products are not listed.
Ruhi Patel, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... plated on solid NGM supplemented with 8 mM isopropyl β-D-1-thiogalactopyranoside (IPTG, Laguna Scientific), and incubated for 16 to 24 h at 25° C ...
-
No products found
because this supplier's products are not listed.
Maho Yamashita, et al.,
bioRxiv - Biochemistry 2023
Quote:
Apiin and apigenin 7-O-β-D-glucoside were purchased from Ark Pharm (Arlington Heights, IL). Apigenin was purchased from Cayman Chemical (Ann Arbor ...
-
No products found
because this supplier's products are not listed.
Ani Paloyan, et al.,
bioRxiv - Biochemistry 2023
Quote:
... After two weeks crystals were found in row D of the PACT premier screen (Molecular Dimensions). An optimisation screen based on this condition was set up in 24 well plates by varying the PEG1500 concentration and MMT buffer pH ...
-
No products found
because this supplier's products are not listed.
Victoria L. Messerschmidt, et al.,
bioRxiv - Bioengineering 2021
Quote:
Poly(D, L-lactide-co-glycolic acid) nanoparticles (PLGA, 50:50, Akina Inc., West Lafayette, IN, USA) of two different molecular weights including 55–65 kDa (HMW Nanoparticles ...
-
No products found
because this supplier's products are not listed.
Shaun Scaramuzza, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Adherent cells were washed twice with Dulbecco’s PBS (-) (D-PBS (-)) and treated with DirectPCR Lysis Reagent (Viagen: 0.5X DirectPCR Lysis Reagent ...
-
No products found
because this supplier's products are not listed.
Maria Hauge Pedersen, et al.,
bioRxiv - Cell Biology 2020
Quote:
... The human μ/κ/d/Nociceptin opioid receptors were all inserted into the pMEX2 vector from Multispan.
-
No products found
because this supplier's products are not listed.
Tom Hindmarsh Sten, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and subsequently tethered to a stainless-steel insect pin (size 00, d=0.3mm, l=4cm, Fine Science Tools) by their thorax ...
-
No products found
because this supplier's products are not listed.
Bo Wei, et al.,
bioRxiv - Neuroscience 2023
Quote:
... D/V: 4.3∼4.7 mm) of retrograde fluorescence microbeads (Lumafluor Inc., Red Retrobeads TM IX; 100∼150 nl).
-
Poly-D-Lysine comes with 5 mg of sterile powder. Poly-D-Lysine is a synthetic amino acid chain...
Cat# 5174-5MG,
5 mg, USD $85.0
Ask
Wenqing Wang, et al.,
bioRxiv - Cell Biology 2021
Quote:
... a 96-well Seahorse cell culture plate was coated with 0.1 mg/mL Poly-D-Lysine (Advanced Biomatrix 5174). Sorted promyelocytes ...
-
No products found
because this supplier's products are not listed.
Ryutaro Ariyoshi, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and MTG mutant was purified with size exclusion chromatography using ProteoSEC-D 16/60 6-600 HR (Protein Ark) with PBS (pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Alberto Perez-Alvarez, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and 4 μM cytosine β-D-arabinofuranoside added 48 hours after plating in 6 mm diameter cloning cylinders (Ace Glass).
-
No products found
because this supplier's products are not listed.
Hyunsu Jeon, Runyao Zhu, Gaeun Kim, Yichun Wang,
bioRxiv - Bioengineering 2023
Quote:
The size and shape of L/D-GQDs were characterized by a transmission electron microscope (TEM; JEOL 2011; Joel, WA). A 3-μL droplet of the L/D-GQD solution (0.1 mg·mL-1 ...
-
No products found
because this supplier's products are not listed.
Maria Font Farre, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 600 mM D-Sorbitol) and ground using 0.5 mm glass beads and a bead mill homogenizer (BioSpec BeadBeater 1107900-105). The cell extract was filtered through a nylon cloth and centrifuged at 16,000 x g for 10 min ...
-
No products found
because this supplier's products are not listed.
Tetsuro Yamamoto, et al.,
bioRxiv - Immunology 2023
Quote:
... HRP-human IgG antibody (EY Laboratories, USA), and BT IgE antibody (Bio-Rad Laboratories ...
-
No products found
because this supplier's products are not listed.
Giovannino Silvestri, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... anti-SET (Globozymes); anti-ABL (Ab-3) ...
-
No products found
because this supplier's products are not listed.
Haopeng Yang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The purified proteins 10 mg/ml were mixed with CoA at a ratio of 1:10 in buffer D and used for crystallization screening using the sitting drop vapour diffusion method with the Mosquito (TTP Labtech) automated crystallization system ...
-
No products found
because this supplier's products are not listed.
Narayan Pokhrel, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
... were collected from a commercial farm and stored at 18°C or 12°C up to 28 d in a cooled incubator (SN 265959, VELP SCIENTIFICA, Italy). The temperature and relative humidity of cooled incubator was continuously monitored throughout the experiment ...
-
No products found
because this supplier's products are not listed.
Eric M. Strohm, et al.,
bioRxiv - Bioengineering 2022
Quote:
... cantilever D with nominal spring constant of 0.03 N/m) were functionalized using 10 µm radius spherical polystyrene beads (Phosphorex Inc. Hopkinton, MA). A contact-based thermal tune method was applied to determine the precise spring constants ...
-
No products found
because this supplier's products are not listed.
Ying He, et al.,
bioRxiv - Immunology 2023
Quote:
... 1 ml TRIzol was added into each frozen Lysing Matrix D tube to pulverize the colon tissue with a homogenizer (Mini-Beadbeater, Biospectra, Stroudsburg, PA) by homogenizing 45 seconds twice ...
-
No products found
because this supplier's products are not listed.
Ayush Saurabh, et al.,
bioRxiv - Biophysics 2023
Quote:
HeLa cells (Kyto strain) were grown in 60 mm glass petri dishes on Poly-d-lysine coated 40 mm #1.5 coverslips (Bioptechs, 40-1313-03192) for a minimum of 48 h in DMEM media (ATCC 30-2002 ...
-
Luciferase substrate
Sold for research purposes only.
Cat# 2494.0, SKU# 2494-10 mg,
10mg, US $104.50 / EA, EURO, €95 / EA
Ask
Isabel R.K. Kuebler, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... The MCH receptor antagonist 6-(4-Chloro-phenyl)-3-[3-methoxy-4-(2-pyrrolidin-1-yl-ethoxy)-phenyl]-3H-thieno[3,2-d]pyrimidin-4-one (GW803430) (Axon Medchem, Groningen, Netherlands) was freshly prepared the day of the treatment ...
-
No products found
because this supplier's products are not listed.
G.H.U. Lamm, et al.,
bioRxiv - Biophysics 2024
Quote:
... in the crystallization buffer was mixed with octyl-β-D-Glucopyranosid (OG, Glycon) and then with the premelted at 42°C monoolein (MO, Nu-Chek Prep) in a 2:1 ratio (protein/OG:lipid ...
-
No products found
because this supplier's products are not listed.
Luyang Xiong, et al.,
bioRxiv - Immunology 2023
Quote:
... After 24 hours cells were washed with 1x D-PBS and incubated in HFSC Serum Free Un-differentiation Media (Celprogen cat.# M36007-08U) overnight ...
-
No products found
because this supplier's products are not listed.
Sanne van der Niet, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Dihydrochloride) detection was performed using anti dinitrophenol (DNP) (Polyclonal Anti-DNP, Oxford Biomedical Research). All antibodies were diluted in 1% BSA in PBS ...
-
No products found
because this supplier's products are not listed.
Tilman Busch, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... The analytical column was self-packed with silica beads coated with C18 (Reprosil Pur C18-AQ, d = 3 Â) (Dr. Maisch HPLC GmbH, Ammerbusch, Germany). For peptide separation ...
-
No products found
because this supplier's products are not listed.
Hristos S. Courellis, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The stim pair dichotomy corresponds to the grouping of stimuli for which the response is the same in either context (A&C vs. D& B; see Fig. S2). The parity dichotomy is the balanced dichotomy with the maximal non-linear interaction between the task variables (Fig ...
-
No products found
because this supplier's products are not listed.
Renee C. Geck, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Antibodies were used at indicated dilutions in 5% milk (Andwin Scientific) in TBST buffer (Boston Bioproducts) ...
-
No products found
because this supplier's products are not listed.
Adriana C. Camarano, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... rabbit anti-TH (1:1000; 657012, Calbiotech); chicken anti-TH (1:1000 ...
-
No products found
because this supplier's products are not listed.
Hongbing Zhang, et al.,
bioRxiv - Bioengineering 2020
Quote:
The E-ALPHA® human scFv antibody phage display libraries (Eureka Therapeutics) were used for the selection of human antibody constructs specific to SARS-CoV-2 spike protein ...
-
No products found
because this supplier's products are not listed.
Ying Zhu, et al.,
bioRxiv - Systems Biology 2022
Quote:
... anti-TIMM23 (1:1000, mouse, DB Biotech, 611222). After washing 3 times with TBST ...
-
No products found
because this supplier's products are not listed.
Michael P. Motley, et al.,
bioRxiv - Immunology 2020
Quote:
Antibodies were produced weekly over six months from respective hybridomas grown in CELLine (Wheaton) flasks fed with High-Glucose DMEM + 10% NCTC media and 1x Penicillin-Streptomycin and 1x Non-Essential Amino Acids ...
-
No products found
because this supplier's products are not listed.
Lebogang N. Maruma, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Cell Signalling Technology antibodies and Promega luminometry kits were procured from Anatech (Johannesburg, South Africa). All other reagents were purchased from Merck (Darmstadt ...
-
No products found
because this supplier's products are not listed.
Steven G. Sayson, et al.,
bioRxiv - Immunology 2024
Quote:
... anti-Citrullinated Histone H3 (1:100; Abbomax, San Jose, California), or anti-Myeloperoxidase (1:100 ...
-
No products found
because this supplier's products are not listed.
Ragna S. Häussler, et al.,
bioRxiv - Biochemistry 2019
Quote:
... the antibody-coupled beads were washed three times in 100 μl 1x PBS (09-9400, Medicago), 0.05% Tween20 (BP337 ...
-
No products found
because this supplier's products are not listed.
Sameer Ahmed Bhat, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-phospho-cofilin-S3 (St Johns Laboratory, STJ90230; 1:2000 IB); anti-cofilin (CST ...
-
No products found
because this supplier's products are not listed.
István Fodor, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2) incubation with a rabbit anti-ap-GnRH/CRZ antiserum (#AS203-2, EZbiolab; antigen was a synthetic undecapeptide ...
-
No products found
because this supplier's products are not listed.
Eun Hye Kim, et al.,
bioRxiv - Microbiology 2022
Quote:
... Cells were washed and stained with antibodies against cell surface molecules in PBS containing 4% of human serum (Valley Biomedical). NGFR was detected with a 20 μl per million cells of Alexa Flour 647 conjugated α-NGFR (BD Bioscience) ...
-
No products found
because this supplier's products are not listed.
Tadayuki Komori, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Each cover glass was placed on a 35 μL spot of diluted primary antibody solution made on a sheet of parafilm (Bemis) so that the surface with cells present is facing the antibody solution45 ...
-
No products found
because this supplier's products are not listed.
Lucy Ngo, et al.,
bioRxiv - Systems Biology 2019
Quote:
▪ Lint free cotton swab with anti-static handle (Puritan Medical Products, SKU#: 876-PPC)
-
No products found
because this supplier's products are not listed.
Irmgard U. Haussmann, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... a T7 promoter oligonucleotide (CCTGGCTAATACGACTCACTATAG) was annealed to an anti-sense Ultramer (IDT DNA) encoding the entire sgRNA in addition to the T7 promoter ...
-
No products found
because this supplier's products are not listed.
Grzegorz Maciag, et al.,
bioRxiv - Cell Biology 2024
Quote:
... After antibody staining the tissue was washed 6 times in PBS and before imaging the tissue was incubated in RapiClear (SUNJin Lab) for 30-60 minutes at room temperature ...
-
Apoptosis can be mediated by mechanisms other than the traditional caspase-mediated cleavage...
Cat# Kit-0182,
100 assays : USD $798
Ask
Yan Qi, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... the presence of anti- Ad and anti-hemagglutinin antibodies was measured by ELISA against a purified Ad6 virus preparation (Greffex, Inc.) and a recombinant hemagglutinin protein (Creative Biomart). In the first case ...
-
No products found
because this supplier's products are not listed.
Rodney M. Ritzel, et al.,
bioRxiv - Neuroscience 2022
Quote:
... sections were mounted onto glass slides with coverslips using an anti-fade Hydromount solution (National Diagnostics). The following primary and secondary antibodies were used ...
-
No products found
because this supplier's products are not listed.
Machmouchi Dana, et al.,
bioRxiv - Microbiology 2024
Quote:
... ZIKV infectivity was assessed using the mouse anti-E protein mAb 4G2 (RD-Biotech, Besançon, France). Antibody donkey anti-mouse Alexa Fluor 488 IgG (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Kristina D. Micheva, et al.,
bioRxiv - Neuroscience 2023
Quote:
... A 10 nm gold-labeled goat anti-mouse IgG secondary Ab (SPI Supplies, West Chester, PA) was used at 1:25 for 1 hr ...
-
No products found
because this supplier's products are not listed.
Ashok Pabbathi, et al.,
bioRxiv - Biophysics 2021
Quote:
... We washed out excess antibody with BRB80 and then incubated the flow channel with 1% Pluronic F-127 (PK-CA707-59000, PromoCell Inc., Heidelberg, Germany) for 5 min to passivate the surface ...
-
No products found
because this supplier's products are not listed.
M Kouwenberg, et al.,
bioRxiv - Immunology 2020
Quote:
... To analyze DC maturation cells were stained with anti-CD11c (clone N418, IQ products, Groningen, the Netherlands), anti-CD40 (clone FGK45.5 ...
-
No products found
because this supplier's products are not listed.
Anh T. P. Ngo, et al.,
bioRxiv - Cell Biology 2023
Quote:
Thrombin anti-thrombin complexes in septic plasma were measured using commercially available ELISA kits (AssayPro; EMT1020-1) according to manufacturers’ instructions ...
-
No products found
because this supplier's products are not listed.
Ankita Datey, et al.,
bioRxiv - Microbiology 2019
Quote:
The serum samples were also subjected to indirect ELISA to detect the presence of IgG antibodies against JEV using Porcine JE IgG ELISA Kit (Glory Science Co., Ltd, USA) in accordance with the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Mitsuhiro Abe, et al.,
bioRxiv - Cell Biology 2024
Quote:
... The cells were washed and incubated with HMSiR-coupled goat anti-rabbit IgG (#A204-01, GORYO Chemical, Inc.).