-
A1BG Antibody is a Rabbit Polyclonal against A1BG.
Cat# abx333946-200UG,
200 µg USD $710.5
Ask
Bálint Kiss, et al.,
bioRxiv - Biophysics 2020
Quote:
... 100 μl of 10 μg/ml SARS-CoV-2 Spike Glycoprotein Antibody (#abx376478, Abbexa Ltd, Cambridge, UK) was then added ...
-
Recombinant Antigen
Cat# CMV-GPB-50,
50µg USD $869.0
Ask
Maya Imbrechts, et al.,
bioRxiv - Immunology 2021
Quote:
... Spike Glycoprotein (Full-Length)-His (REC31868-500, The Native Antigen Company). Briefly ...
-
No products found
because this supplier's products are not listed.
Maria Jose Lista, et al.,
bioRxiv - Microbiology 2021
Quote:
... a set of overlapping cDNA fragments representing the entire genomes of SARS-CoV-2 Wuhan isolate (GenBank: MN908947.3) and the B.1.1.7 alpha variant were chemically synthesized and cloned into pUC57-Kan (Bio Basic Canada Inc and Genewiz, respectively). The cDNA fragment representing the 5’ terminus of the viral genome contained the bacteriophage T7 RNA polymerase promoter preceded by a short sequence stretch homologous to the XhoI-cut end of the TAR in yeast vector pEB2(Gaida et al. ...
-
No products found
because this supplier's products are not listed.
George D. Moschonas, et al.,
bioRxiv - Microbiology 2023
Quote:
... culture medium was supplemented with recombinant human interferon-alpha 2 alpha (rhIFN-a2a) (#11343504, ImmunoTools), doxycycline (#D9891 ...
-
No products found
because this supplier's products are not listed.
Taru Hilander, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... 1% N-Dodecyl-b-D-Maltoside (Amresco, J424,), 1% Phenylmethanesulfonyl fluoride (PMSF ...
-
No products found
because this supplier's products are not listed.
Sophie L. Lewandowski, et al.,
bioRxiv - Cell Biology 2020
Quote:
... with an alpha plate reader (TECAN Spark). After the perifusion ...
-
No products found
because this supplier's products are not listed.
Bing Han, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
No products found
because this supplier's products are not listed.
MU Wagenhäuser, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... For the platelet depletion experiments mice were injected with platelet depletion antibody (Emfret Analytics, polyclonal anti-GPIb alpha #R300) and a corresponding IgG antibody (Emfret Analytics ...
-
No products found
because this supplier's products are not listed.
EA Monson, et al.,
bioRxiv - Immunology 2023
Quote:
... 800 µl of 1 x reagent B (Cell Biolabs; Cat; MET-5011) was added to the cells/ tissues and further incubated on ice for 10 mins with occasional vortexing ...
-
No products found
because this supplier's products are not listed.
Adelaide Tovar, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... All animals were housed in groups of 1-5 on ALPHA-Dri bedding (Shepard) with ad libitum food (Envigo 2929) and water ...
-
No products found
because this supplier's products are not listed.
Eline Lemerle, et al.,
bioRxiv - Cell Biology 2022
Quote:
... myotubes were grown on alpha-numerically gridded bottom dishes (Ibidi, France). Adherent plasma membranes were obtained by sonication and were immediately immersed in 4% paraformaldehyde and the proteins of interest were then labeled by immunofluorescence in saturation buffer (1% BSA in KHMgE buffer) ...
-
No products found
because this supplier's products are not listed.
Annette Choi, et al.,
bioRxiv - Microbiology 2023
Quote:
... we designed and ordered linear peptides that mimic the S1/S2 domain of the S glycoprotein for selected coronaviruses (Biomatik, Kitchener, Ontario). Information about the series of amino acid residues within the S1/S2 domain were obtained from NCBI ...
-
No products found
because this supplier's products are not listed.
Jörg Schweiggert, et al.,
bioRxiv - Cell Biology 2021
Quote:
... energy regeneration solution (B-10, Boston Biochem) in assay buffer were carefully pipetted directly on the arrays ...
-
No products found
because this supplier's products are not listed.
Charlotte Repton, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 2 µg/mL Latrunculin B (Cambridge Bioscience), 0.1 mM DTT (Promega ...
-
No products found
because this supplier's products are not listed.
Adam Myszczyszyn, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and 125 µg/ml Amphotericin B (Biomol). Whole kidneys were minced into pieces smaller than 1 mm3 ...
-
No products found
because this supplier's products are not listed.
Kai-Ting Huang, et al.,
bioRxiv - Physiology 2024
Quote:
... IP3R2 (Antibody Research Corporation; 1:1000), IP3R3 (BD Transduction Laboratory ...
-
No products found
because this supplier's products are not listed.
Merel P.M. Damen, et al.,
bioRxiv - Microbiology 2022
Quote:
... Beads were then washed with buffer B and proteins were eluted using buffer B supplemented with 10 mM desthiobiotin (IBA Lifesciences). Samples were taken at each step of the purification and loaded on SDS-PAGE gels to check the efficiency of affinity purification ...
-
No products found
because this supplier's products are not listed.
Sébastien Campagne, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... and 60 mg/L of alpha-ketoisovaleric acid (13C5, 98%; 3-D1, 98%, Cambridge Isotope Laboratory). All the recombinant protein expressions were performed at 37°C during 4 hours in presence of 1 mM IPTG.
-
No products found
because this supplier's products are not listed.
Zsuzsa Csobán-Szabó, et al.,
bioRxiv - Biochemistry 2021
Quote:
... monoclonal anti-TG4 antibody (Covalab; 1/2500) and monoclonal anti-polyHis/HRP antibody (Sigma ...
-
No products found
because this supplier's products are not listed.
Alexandru-Ioan Voda, et al.,
bioRxiv - Genomics 2023
Quote:
... Human Anti-CD27 agonist antibody (100111-1, AMSBio) and Mouse Anti-CD6 agonist antibody (Clone UMCD6 ...
-
No products found
because this supplier's products are not listed.
Courtney M. Smith, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Raji B cells were obtained from American Type Culture Collection and were cultured in RPMI-1640 media supplemented with 10% FCS ...
-
No products found
because this supplier's products are not listed.
Xuan G. Luong, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... 1:200 human antibody against centromere (ImmunoVision, HCT-0100). After another round of washing ...
-
No products found
because this supplier's products are not listed.
Andrea Scelfo, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... incubated with 5mC primary antibody (1:1000; A-1014 Epigentek) 1h and after three washes in TBS-0.1% tween ...
-
No products found
because this supplier's products are not listed.
Rashmi J. Kumar, et al.,
bioRxiv - Cell Biology 2020
Quote:
... The primary antibodies used were: γH2AX (1:500, Trevigen, 4418-APC-100), and 53BP1 (1:500 for immunofluorescence ...
-
No products found
because this supplier's products are not listed.
Masato Sadahiro, et al.,
bioRxiv - Neuroscience 2020
Quote:
... sections were labeled with rabbit anti-somatostatin antibodies (1:1000; Peninsula Laboratories) and the SST interneuron-specific GFP expression was confirmed ...
-
No products found
because this supplier's products are not listed.
Adrianna J. Milton, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Primary antibodies targeting SERT (1/1000; EnCor Biotechnology; Cat No. RPCA-SERT) and WFA-Lectin (1/1000 ...
-
No products found
because this supplier's products are not listed.
Aikaterini Kalamari, et al.,
bioRxiv - Animal Behavior and Cognition 2020
Quote:
... except for 7 pairs of males from pilot experiment B that originated directly from Charles River. Only male rats were included in the experiments ...
-
No products found
because this supplier's products are not listed.
Vibeke D. Valderhaug, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 1mg alpha-synuclein monomers (S-1001-1, rPeptide) was resuspended in 1mL MilliQ water ...
-
No products found
because this supplier's products are not listed.
Jaganathan Subramani, et al.,
bioRxiv - Microbiology 2021
Quote:
... or RBD-C tag (Dyadic International, Jupiter, FL) or different variants of spike protein B.1.1.7 (Alpha; Cube Biotech # 28718), B.1.351 (Beta ...
-
No products found
because this supplier's products are not listed.
Elisa Matas-Rico, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Granzyme B-PE (1:200, clone GB11, Sanquin Amsterdam). To detect cytokine production ...
-
No products found
Armin Bayati, et al.,
bioRxiv - Neuroscience 2023
Quote:
alpha-synuclein-HA-tag adenovirus were obtained from Applied Biological Materials Inc ...
-
No products found
because this supplier's products are not listed.
Sonam Gurung, et al.,
bioRxiv - Genetics 2023
Quote:
... respectively (BioSpec B-GA 12S2), 86 mm volume coil ...
-
No products found
because this supplier's products are not listed.
Joel Lang Yi Ang, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and Rhodamine B (A5102, TCI) fluorescence stains were prepared at various concentrations for optimal staining of different tissue types ...
-
No products found
because this supplier's products are not listed.
Léa Paolini, et al.,
bioRxiv - Immunology 2024
Quote:
... with alpha-galactosylceramide (α-GalCer) as an adjuvant (Funakoshi, Tebu-bio France). On day 21 ...
-
No products found
because this supplier's products are not listed.
Tsung-Han S. Hsieh, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... the pellet was resuspended to 350 μl of 1 M buffer B and sonicated (Covaris S220 sonicator ...
-
No products found
because this supplier's products are not listed.
Timothy J. Aikin, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Prime 95-B sCMOS camera (Photometrics) and a Multiline laser launch (Cairn Research ...
-
No products found
because this supplier's products are not listed.
Shijie Cao, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Azide-labelled pHPMA-b-pBMA or pMAA-b-pBMA polymer was reacted with AFDye647-DBCO (Click Chemistry Tools) and then formulated into micelles ...
-
No products found
because this supplier's products are not listed.
Caroline Koch, et al.,
bioRxiv - Biophysics 2022
Quote:
... B-type natriuretic peptide (4095916, Bachem, Switzerland); cardiac troponin I (Z03320 ...
-
No products found
because this supplier's products are not listed.
Emily A Wheeler, et al.,
bioRxiv - Immunology 2023
Quote:
... and Factor B were purchased from Complement Technologies.
-
No products found
because this supplier's products are not listed.
Xiaodan Zhang, et al.,
bioRxiv - Genomics 2021
Quote:
... anti-mouse Lyve1 antibody (1:100, AngioBio cat.no ...
-
PhotoDextran® is 1 gram of lyophilized methacrylated dextran. PhotoDextran® provides 3D...
Cat# 5311-1GM,
1 gram, USD $305.0
Ask
Evelien Eenjes, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 10 μg/mL PureCol (Advanced Biomatrix; 5005-B) for 2 hrs at 37°C ...
-
No products found
because this supplier's products are not listed.
Rebecca L. Schmitz, et al.,
bioRxiv - Bioengineering 2023
Quote:
... B cells and NK cells were plated 1 hour before imaging on poly-D-lysine coated glass-bottomed dishes (MatTek) at a seeding density of 200,000 cells in 50 μL media ...
-
No products found
because this supplier's products are not listed.
Irina Sbornova, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Whole eye blots were probed overnight at 4 °C with 1 of two PDE11A antibodies: the pan-PDE11A antibody PD11-112 (1:1000, rabbit, Fabgennix) or the PDE11A4-specific antibody PDE11A#1-8113A (1:10,000 ...
-
No products found
because this supplier's products are not listed.
Nadège Gouignard, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... at 100 μg/mL or Magenta-Phos (Biosynth, B-7452). The following probes were used ...
-
B-Raf IN 1 is an inhibitor of Raf wih IC50 values of 24 nM and 25 nM for B-Raf and C-Raf...
Cat# S6538, SKU# S6538-2mg,
2mg, $187.00
Ask
Bo-Ruei Chen, et al.,
bioRxiv - Cell Biology 2021
Quote:
... abl pre-B cells were treated with 3 μM imatinib (Selleck Chemicals, S2475) for 2 (for chromatin-bound RPA assay ...
-
No products found
because this supplier's products are not listed.
Haiqing Fu, et al.,
bioRxiv - Genomics 2020
Quote:
... a rat antibody directed against BrdU (Accurate chemical, OBT0030, 1:200 dilution) and a mouse antibody directed against single-stranded DNA (ssDNA ...
-
No products found
because this supplier's products are not listed.
Kim M. Stegmann, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Primary antibodies were used to stain dsRNA (SCICONS J2 #10010200, 1:500) as well as the SARS-CoV-2 Spike (S ...
-
No products found
because this supplier's products are not listed.
Boris P. Chagnaud, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Current pulses were delivered via a constant current source (model 305-B, World Precision Instruments). A stimulus generator (A310 Accupulser ...
-
No products found
because this supplier's products are not listed.
Srinu Tumpara, et al.,
bioRxiv - Cell Biology 2020
Quote:
... mouse monoclonal anti-AAT polymer antibody (clone 2C1, 1:500, Hycult Biotech, Uden, The Netherlands), rabbit polyclonal anti-CX3CR1 (1:500 ...
-
No products found
because this supplier's products are not listed.
Yongfei Cai, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 3.5 μl of the freshly purified sample from the peak fraction in DDM at ~2.0 mg/ml for the B.1.1.7 protein or ~1.5 mg/ml for the B.1.351 protein was applied to a 1.2/1.3 Quantifoil grid (Quantifoil Micro Tools GmbH), which had been glow discharged with a PELCO easiGlow™ Glow Discharge Cleaning system (Ted Pella ...