-
No products found
because this supplier's products are not listed.
Aditya R. Yelamali, et al.,
bioRxiv - Immunology 2024
Quote:
... streptavidin-azide (SAv-azide; 2-4 azide groups per tetramer, Protein Mods) at 2-5 mg/mL stock concentration in PBS was prepared for payload conjugation by first adding DMSO to 20% final concentration as cosolvent.
-
No products found
because this supplier's products are not listed.
Yildirim Dogan, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Quality controls of A1cNow kit were performed with NOVA-ONE kit levels 1 & 2 (NOVA-ONE Diagnostics, Calabazas, CA).
-
No products found
because this supplier's products are not listed.
Rio Ikuta, Yuu Kakinohana, Shun Hamada,
bioRxiv - Neuroscience 2023
Quote:
... the nuclei were labeled with 4’,6-diamidino-2-phenylindole (DAPI, 1 μg/mL) and then coverslipped with a mounting medium (Fluoroshield Mounting Medium; ImmunoBioScience, CA, USA). Images were obtained using a fluorescence microscope (Eclipse E800 ...
-
No products found
because this supplier's products are not listed.
Bettina M. Fuglerud, et al.,
bioRxiv - Genomics 2021
Quote:
... at 4 °C overnight in CHAPS immunoprecipitation buffer (Fivephoton Biochemicals). After washing in TBST ...
-
No products found
because this supplier's products are not listed.
Michelle M. Dominguez, et al.,
bioRxiv - Plant Biology 2022
Quote:
... then were carefully sub-cultured to 3×4 Magenta GA-7 vessels (Bio-World, Dublin, OH). The seeds remained under these conditions until epicotyls grew to approximately 7.5 cm in height ...
-
No products found
because this supplier's products are not listed.
Kazuya Matsuo, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Human frozen brain sections (5–10 μm thickness) were obtained from BioChain Institute and a part of them were treated with RNase A ...
-
No products found
because this supplier's products are not listed.
Ming Yang, et al.,
bioRxiv - Cell Biology 2019
Quote:
... rabbit anti-total Rac1 (1:10; NewEast Biosciences); mouse anti-CD44 (1:100 ...
-
No products found
because this supplier's products are not listed.
Arumoy Chatterjee, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... The deuterated internal standards 2-(4-Hydroxyphenyl)ethyl-1,1,2,2-d4-amine HCl and beta-Hydroxytyramine (α-d2, β-d1) HCl were supplied by Medical Isotopes, Inc ...
-
No products found
because this supplier's products are not listed.
Vivian Tam, et al.,
bioRxiv - Systems Biology 2020
Quote:
... (McGill University) and one aged (59M) from Articular Engineering, LLC (IL ...
-
No products found
because this supplier's products are not listed.
David L. Goldblatt, et al.,
bioRxiv - Immunology 2019
Quote:
... Sections were stained with Sudan black B (Rowley Biochemical, Danvers, MA) for 1 h and counterstained with Kernechtrot’s nuclear fast red (Rowley ...
-
No products found
because this supplier's products are not listed.
Lucy I. Crouch, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Control samples were digested with PNGase F (1 μl, 5 mU, QA-Bio) For Pngase-003341 the final enzyme concentration was 1 μM ...
-
No products found
because this supplier's products are not listed.
Nishith M Shrimali, et al.,
bioRxiv - Pathology 2021
Quote:
... and incubated with collagen (10 µg/ml) or ADP (2 µM, both from the Bio/Data Corporation, USA) 10 minutes ...
-
No products found
because this supplier's products are not listed.
Vipul Sharma, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... and RT All-in-one master mix (Lamda Biotech G208-100). Endpoint PCR was done using EV primers (Forward – CGGCCCCTGAATGCGGCTAATCC ...
-
No products found
because this supplier's products are not listed.
Lee Admoni-Elisha, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... U251 cells were infected with the viral supernatants and selected with 500 μg/ml hygromycin B (TOKU-E).
-
No products found
because this supplier's products are not listed.
Robin Mesnage, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... Cells were exposed to five concentrations of the test samples in the absence and presence of 0.25% S9 extract and required co-factors (RegenSysA+B, Moltox) for 24 h ...
-
No products found
because this supplier's products are not listed.
Ana J. Chucair-Elliott, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and positive fraction) and mouse methylation controls (#80-8063-MGHM-5 and #80-8064-MGUM-5; EpigenDX, Hopkinton, MA) were diluted in nuclease free elution buffer (Qiagen ...
-
No products found
because this supplier's products are not listed.
Oihana Iriondo, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... KDM5-C70 (Xcess Biosciences, M60192-2), NSC636819 (Sigma ...
-
No products found
because this supplier's products are not listed.
James S. Novak, et al.,
bioRxiv - Cell Biology 2020
Quote:
... to the tendons of the peroneus longus 28. The skin was then closed with Histoacryl surgical glue (B. Braun) and Reflex stainless-steel wound clips (CellPoint Scientific). Buprenorphine SR (1 mg/kg ...
-
No products found
because this supplier's products are not listed.
Fatima Abbas, et al.,
bioRxiv - Neuroscience 2023
Quote:
The mutated toxin AaH-IIR62K was the one described in a previous report [26] and it was produced by Smartox Biotechnology (Saint Egrève ...
-
No products found
because this supplier's products are not listed.
Saige Lorraine Pompura, et al.,
bioRxiv - Immunology 2020
Quote:
... NEFA concentration in plasma and WAT (chloroform:methanol extraction 2:1) were determined using the WAKO HR Series NEFA-HR2 in vitro enzymatic colorimetric assay (FUJIFILM Wako Diagnostics, USA).
-
No products found
because this supplier's products are not listed.
Zhilei Zhao, et al.,
bioRxiv - Neuroscience 2020
Quote:
... All extractions were supplied by charcoal-filtered tank air that was pulled through one or two Tenax TA tubes (Markes International Inc., C1-CAXX-5003) using a vacuum pump (Sensidyne, Gilian 800i). Flow rate and extraction duration ...
-
No products found
because this supplier's products are not listed.
Veronika Mikhaylova, et al.,
bioRxiv - Genomics 2023
Quote:
... to remove primers plus one or two rounds of 0.41x HighPrep™ PCR Clean-up beads (Cat. #AC-60050; MagBio Genomics®) for 13 kb SCN10A amplicons ...
-
No products found
because this supplier's products are not listed.
Tyler P. Nicholas, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... or to silver nanoparticles (AgNP; 20 nm, gold-core, citrate-coated, at 1 mg/mL in 2 mM sodium citrate; nanoComposix, San Diego, CA, USA) for an acute exposure of 24 hours ...
-
No products found
because this supplier's products are not listed.
Yuichi Shichino, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and then incubated with 150 μl of FLAG elution buffer (FLAG wash buffer 2 with 1 mg/ml 3×FLAG peptide [Protein Ark, GEN-3XFLAG-25]) overnight ...
-
No products found
because this supplier's products are not listed.
Heather Swann, et al.,
bioRxiv - Biophysics 2020
Quote:
... followed by a brief dd-H20 wash to get rid of excess neutravidin and incubation with biotinylated anti-S antibody (11-2001-B, Abeomics, San Diego, CA, USA). Surfaces thus prepared were generally devoid of debris but sometimes had step-edge character suggesting that antibody coating was less than a full monolayer (Figure S4) ...
-
No products found
because this supplier's products are not listed.
Joanna M. Cooper, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Alpha-2-macroglobulin was purchased from Athens Research and was activated by methylamine as described (Ashcom et al. ...
-
No products found
because this supplier's products are not listed.
Marco Santorelli, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... containing 10% fetal bovine serum (Laguna Scientific) and tetracycline (100 ng/ml ...
-
Creative-Proteomics Porcine Cytokine Glass protein array, detected 10 Porcine proteins. Suitable...
Cat# PQ-CPA-CPG-4,
inquiry, contact supplier for pricing
Ask
J. M. Kirkland, et al.,
bioRxiv - Neuroscience 2023
Quote:
Homogenate from two sex- and manipulation-matched rats were pooled into one sample for proteomic analysis carried out by Creative Proteomics (https://www.creative-proteomics.com/).
-
No products found
because this supplier's products are not listed.
Jianmei ZHANG, et al.,
bioRxiv - Microbiology 2019
Quote:
... supplement with 10% FBS (Crystalgen, New York, USA), 1×107 cells/well were seeded in 6 well plates and incubated at 37°C and 5% CO2 ...
-
The enzyme catalyses the second step in archaeal riboflavin and...
Cat# EXWM-4381,
100 ug, contact supplier for pricing
Ask
Junfei Ma, Shuying Wang, Qianyu Ji, Qing Liu,
bioRxiv - Immunology 2021
Quote:
... pylori urease (2 μg in 50 μL, Creative Enzymes, USA) was incubated with purified IgG antibodies (64 μg/well ...
-
No products found
because this supplier's products are not listed.
Clémence Boutry, et al.,
bioRxiv - Microbiology 2022
Quote:
... and on 2 June (only ‘Otava’, ‘Rajika’, ‘Rubinola’, and ‘Boskoop’). Trees with spore traps were excluded from receiving fungicide treatments in 2019 and 2020 ...
-
No products found
because this supplier's products are not listed.
Pallavi Raj Sharma, et al.,
bioRxiv - Bioengineering 2021
Quote:
PLGA (Mw 10-15 kDa 50:50, Akina AP041) was used to synthesize microparticles using oil in water single emulsion method ...
-
No products found
because this supplier's products are not listed.
Nalin H. Maniya, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 10 healthy plasma samples were purchased from Precision for Medicine.
-
No products found
because this supplier's products are not listed.
Fangyuan Ding, et al.,
bioRxiv - Systems Biology 2020
Quote:
... were coated with 5 ug/ml Human Fibronectin (Oxford Biomedical Research, Rochester Hills, MI) in PBS buffer for 1hr at room temperature ...
-
No products found
because this supplier's products are not listed.
Pengchao Wang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... for 2 min and then subjected to the imaging system (UVITEC Cambridge) to record signals.
-
No products found
because this supplier's products are not listed.
A Prabhakar, et al.,
bioRxiv - Immunology 2021
Quote:
... 2-3 ml blood was collected in RNAgard blood tubes (Biomatrica, USA) and stored in −80°C until RNA precipitation ...
-
No products found
because this supplier's products are not listed.
Ali Ebrahim, et al.,
bioRxiv - Biophysics 2021
Quote:
Individual crystals were harvested using 10 µm MicroMesh™ loops (MiTeGen). For cryogenic temperature ...
-
No products found
because this supplier's products are not listed.
Elizaveta O. Boldinova, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Primer-18 was 5′-labeled with [γ-32P]-ATP by T4 polynucleotide kinase (SibEnzyme, Russia) and annealed to the corresponding unlabeled Template-55 at a molar ratio of 1:1.1 ...
-
No products found
because this supplier's products are not listed.
Elizabeth Fleming, et al.,
bioRxiv - Microbiology 2021
Quote:
... sites were swabbed rigorously using 2 PurFlock Ultra buccal swabs (Puritan Medical Products) for each site for thirty seconds before one swab was submerged into a 1.5mL Eppendorf tube containing 500μl R2A broth (R2A ...
-
No products found
because this supplier's products are not listed.
Nathalie A. Reilly, et al.,
bioRxiv - Genomics 2024
Quote:
... and 20% Dimethyl Sulfoxide (DMSO) (WAK-Chemie Medical GmbH, WAK-DMSO-10) medium ...
-
No products found
because this supplier's products are not listed.
Sanchita Bhadra, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... SARS-CoV-2 N gene armored RNA was obtained from Asuragen (Austin, TX, USA). SARS-CoV-2 viral genomic RNA was obtained from American Type Culture Collection (Manassas ...
-
No products found
because this supplier's products are not listed.
Christopher D. Go, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Beads were then washed with 150 μl of HPLC-grade water (Caledon Laboratory Chemicals CAT# 7732-18-5), centrifuged at 400 RCF for 1 min to pellet beads ...
-
No products found
because this supplier's products are not listed.
Krissie Tellez, et al.,
bioRxiv - Physiology 2019
Quote:
... Plasma GLP-1 levels were quantified with an active GLP-1 ELISA (Eagle Biosciences). Plasma amino acid levels were determined using the L-Amino Acid Quantitation Kit (Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
Jennifer B. Phillips, et al.,
bioRxiv - Neuroscience 2023
Quote:
... α-PCDH15: 1:200 (NSJ Bioreagents); Alexafluor Goat anti-rabbit 488 or 568 (Thermo Fisher).
-
No products found
because this supplier's products are not listed.
Thomas F. Martinez, et al.,
bioRxiv - Genomics 2019
Quote:
... Fluorescein-labeled reference peptide KVFPC(FITC)ALINK was synthesized by covalently coupling of fluorescein to the cysteine residue with 5-(iodoacetamido)fluorescein (Marker Gene Technologies, M0638) for use in the HLA-binding assay ...
-
No products found
because this supplier's products are not listed.
Enikő Lázár, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... 1 U/µl RiboProtect (BLIRT, RT35), 1.0 U/µl T4 Rnl2 (NEB ...
-
No products found
because this supplier's products are not listed.
Alan Dogan, Katherine Dabkowski, Horst von Recum,
bioRxiv - Bioengineering 2020
Quote:
... The surface of a sensor chip CM-5 was conjugated with EDC (0.4 M) and NHS (0.1 M) followed by 10 mM 6-amino-6-deoxy-β-cyclodextrin (CycloLab) suspended in HBS-N buffer (a HEPES balanced salt solution with pH 7.4) ...
-
No products found
because this supplier's products are not listed.
Rahul Sharma, Martin W. Hetzer,
bioRxiv - Cell Biology 2022
Quote:
... mouse Nesprin3 (Nordic-MUBio # MUB1317P,1:250); rabbit Emerin D3B9G XP (CST # 30853) ...
-
No products found
because this supplier's products are not listed.
Peng V. Wu, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... CK19 (rabbit, 1:100, Abbomax 602-670), Ki-67 (rat ...
-
No products found
because this supplier's products are not listed.
Hirofumi Fujita, Takashi Kodama, Sascha du Lac,
bioRxiv - Neuroscience 2020
Quote:
... local field potential was also monitored through extracellular amplifier (ER-1, Cygnus, bandpass frequency range 1-3000 Hz, Cygnus Technology, Delaware Water Gap, PA), 50/60 Hz noise eliminator (HumBug ...