-
No products found
because this supplier's products are not listed.
Yildirim Dogan, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Quality controls of A1cNow kit were performed with NOVA-ONE kit levels 1 & 2 (NOVA-ONE Diagnostics, Calabazas, CA).
-
No products found
because this supplier's products are not listed.
Michelle Zuo, et al.,
bioRxiv - Immunology 2021
Quote:
... incubated with diluted mouse serum (1:8 or 1:16 dilution) and biotinylated detection antibodies (mAB2:1, UmanDiagnostics). Upon adding streptavidin-conjugated β-galactosidase (Quanterix) ...
-
No products found
because this supplier's products are not listed.
Colin Kremitzki, et al.,
bioRxiv - Genetics 2023
Quote:
Lentiviruses carrying the gRNA libraries were packaged into 8×106 HEK 293T cells/well in a 6-well plate (TPP92006, MIDSCI, Fenton, MO, USA), using the TransIT Lentivirus transfection reagent (MIR 6600 ...
-
No products found
because this supplier's products are not listed.
Ruhi Patel, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... plated on solid NGM supplemented with 8 mM isopropyl β-D-1-thiogalactopyranoside (IPTG, Laguna Scientific), and incubated for 16 to 24 h at 25° C ...
-
No products found
because this supplier's products are not listed.
Scot P. Ouellette, et al.,
bioRxiv - Microbiology 2022
Quote:
... 1mM glucose-6-phosphate (Moltox), and 10nM aTc ...
-
No products found
because this supplier's products are not listed.
J. Ignacio Gutiérrez, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 100 uM Gal4–VP16 (Protein One, P1019-02) and 100 uM ATP or AMP-PNP ...
-
No products found
because this supplier's products are not listed.
Jiling Feng, Yuexun Tang, Wenwei Fu, Hongxi Xu,
bioRxiv - Cell Biology 2023
Quote:
... RT-PCR was performed with a one-step real time PCR using KAPA SYBR FAST One-Step qRT-PCR Universal (D-MARK Biosciences). Primers were used as previously described [18] ...
-
No products found
because this supplier's products are not listed.
Marlene Corbet, et al.,
bioRxiv - Pathology 2020
Quote:
... male DBA/1 mice (8-weeks old) were injected intradermally on day 0 with 100 µg Bovine Type II collagen (CII; MD biosciences) in complete Freunds adjuvant (CFA ...
-
No products found
because this supplier's products are not listed.
Vipul Sharma, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... and RT All-in-one master mix (Lamda Biotech G208-100). Endpoint PCR was done using EV primers (Forward – CGGCCCCTGAATGCGGCTAATCC ...
-
No products found
because this supplier's products are not listed.
Rio Ikuta, Yuu Kakinohana, Shun Hamada,
bioRxiv - Neuroscience 2023
Quote:
... the nuclei were labeled with 4’,6-diamidino-2-phenylindole (DAPI, 1 μg/mL) and then coverslipped with a mounting medium (Fluoroshield Mounting Medium; ImmunoBioScience, CA, USA). Images were obtained using a fluorescence microscope (Eclipse E800 ...
-
No products found
because this supplier's products are not listed.
Erkko Ylösmäki, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... while BCG vaccine AJV (2-8×106 C.F.U/vial) from AJ Vaccines (Copenhagen, Denmark) was a kind gift from Professor Helen McShane (University of Oxford).
-
No products found
because this supplier's products are not listed.
Josée Perreault, et al.,
bioRxiv - Immunology 2020
Quote:
... The plates were incubated once again for one hour at RT followed by washing and addition of 100 μl of 3,3’,5,5’-Tetramethylbenzidine (TMB, ESBE Scientific). The colorimetric reaction proceeded for 20 minutes at RT and was stopped by addition of 100 μl of H2SO4 1N (Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Tongcui Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... specimens were diluted 1:1 using a PBS-based Antibody Stabilizer (Boca Scientific) supplemented with 0.05% sodium azide.
-
No products found
because this supplier's products are not listed.
Ilaria Carnevale, et al.,
bioRxiv - Biophysics 2019
Quote:
... penicillin (1%) and streptomycin (1%) and cells have been kept in a CO2 incubator (NuAire, Plymouth, MN, USA), at 5% CO2 and 37°C.
-
No products found
because this supplier's products are not listed.
Momoe Nakajo, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Flash-frozen 50-μL bacterial pellets were dissolved in 500 μL binding buffer (PBS with 0.5 mM EDTA, 1 mM DTT, 1 mM PMSF, 26.3 μM MG-132 [Chemscene, New Jersey ...
-
No products found
because this supplier's products are not listed.
Rebecca Guth-Metzler, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1 µL of each reverse transcription was combined with 1 µL GenefloTM 625 size standard ROX ladder (CHIMERx) and 20 µL HiDi (Applied Biosystems) ...
-
No products found
because this supplier's products are not listed.
Florencia Rammauro, et al.,
bioRxiv - Microbiology 2024
Quote:
... Cells were further incubated 1 h at RT with monoclonal antibodies anti-p24 (BLV3, 1/200, VMRD, USA). After three washes with PBS ...
-
No products found
because this supplier's products are not listed.
Jen M. Hope, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
PC12 cells (NeuroScreen-1 subclone, Cellomics, discontinued) were maintained in complete medium (F12K supplemented with 15% horse serum and 2.5% FBS ...
-
No products found
because this supplier's products are not listed.
Takaya Tominaga, et al.,
bioRxiv - Plant Biology 2021
Quote:
... 1 µM rac-GR24 (StrigoLab, Torino, Italy), and extracted samples (20 µl ...
-
No products found
because this supplier's products are not listed.
Peng V. Wu, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... CK19 (rabbit, 1:100, Abbomax 602-670), Ki-67 (rat ...
-
No products found
because this supplier's products are not listed.
Adriana C. Camarano, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... rabbit anti-TH (1:1000; 657012, Calbiotech); chicken anti-TH (1:1000 ...
-
No products found
because this supplier's products are not listed.
Ming Yang, et al.,
bioRxiv - Cell Biology 2019
Quote:
... rabbit anti-total Rac1 (1:10; NewEast Biosciences); mouse anti-CD44 (1:100 ...
-
No products found
because this supplier's products are not listed.
Zaghi Mattia, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 1× Titan HotTaq EvaGreen qPCR Mix (Bioatlas, Estonia), and 0.4 mM of each primer ...
-
No products found
because this supplier's products are not listed.
Jana Key, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... HSPA9 (Oxford Biomedical Research, GR 02, 1:1000), TRAP1 (Abcam ...
-
No products found
because this supplier's products are not listed.
Radoslaw P. Kozak, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Jack bean α-(1-2,3,6)-Mannosidase (JBAM, QA-Bio); (iii ...
-
No products found
because this supplier's products are not listed.
Yanru Ren, et al.,
bioRxiv - Bioengineering 2019
Quote:
The density was measured by Density balance (OHAUS, precision 1 mg). Triplicate measurements were performed ...
-
No products found
because this supplier's products are not listed.
J. Narasimhan, et al.,
bioRxiv - Microbiology 2021
Quote:
... and 1 U of Ec DNA gyrase (TopoGEN, Buena Vista, CO) or DNA gyrase purified as described above from the Ng 13477 strain was incubated at 37°C for 30 min ...
-
No products found
because this supplier's products are not listed.
Jill V. Hagey, et al.,
bioRxiv - Microbiology 2021
Quote:
... and energy content (Cumberland Valley Analytical Services, Hagerstown, MD; Table 1).
-
No products found
because this supplier's products are not listed.
Gurman Kaur, et al.,
bioRxiv - Immunology 2021
Quote:
... and 2.8 µl of 1 M Trehalose (Life Sciences Advanced Technologies), followed by incubation at 72°C for 3 min and placing on ice ...
-
No products found
because this supplier's products are not listed.
Lin Li, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... and NKX3.1 (0314, dilution 1:500, Athena Enzyme Systems, Baltimore, MD). Images were taken using a Zeiss microscope (White Plains ...
-
No products found
because this supplier's products are not listed.
Laura-Marie A. Zimmermann, et al.,
bioRxiv - Biochemistry 2022
Quote:
... anti-tropoelastin (#PR385, Elastin Products Company, Owensville, MO, USA; IF:1:200), anti-MMP-13 (#ab39012 ...
-
No products found
because this supplier's products are not listed.
Paul Batty, et al.,
bioRxiv - Cell Biology 2023
Quote:
... NIPBL was detected using a rat monoclonal antibody (Absea, 010702F01, 1:500). Sororin was detected using a custom rabbit antibody (1:500) ...
-
No products found
because this supplier's products are not listed.
Dorothy Y. Zhao, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and digested overnight at 37 °C with 1 µg Lys-C (Labchem-wako) and 2µg trypsin (Promega) ...
-
No products found
because this supplier's products are not listed.
Scott Birks, et al.,
bioRxiv - Bioengineering 2023
Quote:
... prior to being tagged with a rabbit anti-nesprin2 antibody (1:300; ImmuQuest IQ565). After primary antibody tagging ...
-
No products found
because this supplier's products are not listed.
Christine Vazquez, Chin Yee Tan, Stacy M. Horner,
bioRxiv - Microbiology 2019
Quote:
... and immunostained with the following antibodies: mouse anti-HCV NS4A (Genotype 1B, 1:100, Virogen), rabbit anti-HA (1:100 ...
-
No products found
because this supplier's products are not listed.
Annett Boeddrich, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... diluted 1:18 in standard diluent delivered with the Arl8b ELISA kit (CUSABIO, CSB-EL002100HU). All steps were performed according to supplier protocols ...
-
No products found
because this supplier's products are not listed.
Maria Georgiou, et al.,
bioRxiv - Cell Biology 2021
Quote:
... and cultured in mTeSR-1 medium supplemented with 10 uM ROCK inhibitor Y-27632 (Chemdea, CD0141) to form Embryonic Bodies ...
-
No products found
because this supplier's products are not listed.
Danielle C. Croucher, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... SPEP was performed with 0.5-1 μL of serum using the QuickGel System (Helena Laboratories, Beaumont, Texas, USA) according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Wenfeng Zeng, et al.,
bioRxiv - Immunology 2022
Quote:
... 5×104 BMDCs were pulsed with 1 mg/ml endotoxin-free chicken egg ovalbumin (OVA, Hyglos GmbH, Germany) in the presence of 50 μg/ml MC38 TEVs or MLC-V ...
-
No products found
because this supplier's products are not listed.
Yukari Nagatoshi, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Samples of 1 to 2 mg were weighed using a microbalance (BM-22; A&D Company Limited, Japan) and analyzed for total N content using an NC analyzer (Series II CHNS/O Analyzer 2400 ...
-
No products found
because this supplier's products are not listed.
Charles E. Mackay, et al.,
bioRxiv - Physiology 2021
Quote:
... Arterial segments 1-2 mm in length were cannulated at each end in a perfusion chamber (Living Systems Instrumentation) continuously perfused with PSS and maintained at 37°C ...
-
No products found
because this supplier's products are not listed.
Marta Scalzotto, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and donor vector (400 ng μl-1) into {Act5C-Cas9.P.RFP-}ZH-2A w[118] Lig[169]flies was performed by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Neloy Kumar Chakroborty, et al.,
bioRxiv - Animal Behavior and Cognition 2023
Quote:
... Primers are listed in Supplementary Table 1 (S1) and Actin was chosen as reference gene (TIB Molbiol, Berlin, Germany). Fold change was calculated using the 2-ΔΔCt method ...
-
No products found
because this supplier's products are not listed.
Emanuel Rognoni, et al.,
bioRxiv - Cell Biology 2021
Quote:
... blocked with 5% BSA/PBS (1 h at room temperature) and stained with the indicated primary antibodies and 5 µM B-CHP (BIO300, 3Helix) overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Sara Meril, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 10μM forward and reverse primers (see Table 1) and 5μL of AzuraView GreenFast qPCR Blue Mix LR (Azura Genomics, AZ2305). Data was analyzed using QuantStudio 5 software (Thermo-Scientific) ...
-
No products found
because this supplier's products are not listed.
Jin-Ran Chen, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Serum bone resorption marker C-terminal telopeptides of type I collagen (CTX-1) was measured by Rat-LapsTM ELISA from Nordic Biosciences Diagnostic (Herlev ...
-
No products found
because this supplier's products are not listed.
Joshua G. Liang, et al.,
bioRxiv - Immunology 2020
Quote:
Endo180-Fc expression vector was generated by subcloning a PCR amplified cDNA encoding soluble human Endo180 (amino acid residue 1-1394) (19) into the HindIII site of pGH-hFc expression vector (GenHunter Corporation) to allow in-frame fusion to human IgG Fc ...
-
No products found
because this supplier's products are not listed.
Dongjin S Shin, et al.,
bioRxiv - Bioengineering 2022
Quote:
... the aqueous phase was prepared as mentioned above and injected into the preheated oil through a 18G syringe needle (1’’ in length, Air-Tite) drop by drop immediately after chitosan preparation ...
-
No products found
because this supplier's products are not listed.
Kathleen N. Brown, et al.,
bioRxiv - Pathology 2023
Quote:
... and the cells were resuspended in ~500 μL 1% FBS in PBS and transferred to polystyrene 5 ml flow cytometry tubes (MTC Bio). The samples were placed on ice and protected from light until flow cytometry could be performed ...
-
No products found
because this supplier's products are not listed.
Maria Kanelli, et al.,
bioRxiv - Bioengineering 2023
Quote:
... The particles are then incubated with PBS buffer with adjusted pH at 8.0 using 1 M dipotassium phosphate with the chelator p-SCN-Bn-Deferoxamine (B-705, Macrocyclics, Plano, TX, USA) overnight at 4 ℃ ...