-
No products found
because this supplier's products are not listed.
Nicolas J. Guehl, et al.,
bioRxiv - Neuroscience 2020
Quote:
4-amino-3-hydroxypyridine and 4-amino-3-methoxypyridine were purchased from Astatech (cat# 22383 and 35474). Anhydrous solvents were purchased from Acros Organics ...
-
No products found
because this supplier's products are not listed.
Tomoya Niinae, Yasushi Ishihama,
bioRxiv - Biochemistry 2023
Quote:
... A coupling system using 1-((Dimethylamino)(dimethyliminio)methyl)-1H-[1,2,3]triazolo[4,5- b]pyridine 3-oxide hexafluorophosphate/N,N-diisopropylethylamine was employed for the introduction of F2Pmp (PEPTIDE INSTITUTE, INC., Osaka, Japan) and a coupling system using 1-hydroxybenzotriazole/2-(1H-Benzotriazole-1-yl)-1,1,3,3- tetramethyluronium hexafluorophosphat/N,N-diisopropylethylamine was employed for the introduction of all other amino acids and a biotin PEG2 acid (Broad Pharm ...
-
No products found
because this supplier's products are not listed.
Rongqun Guo, et al.,
bioRxiv - Immunology 2019
Quote:
8-10-week-old B-NDG mice were sublethally irradiated (2.25 Gy) by an X-ray irradiator (RS2000, Rad Source Inc.). 0.5-1 million PSC-derived iHPC were injected into each irradiated B-NDG mouse via retro-orbital veins ...
-
Cat# 929074-47-5,
Inquire
Ask
Sean P Harrison, et al.,
bioRxiv - Cell Biology 2020
Quote:
... depending on the cell line and 3 or 4 μM CHIR99021 (BOC Sciences). Optimal conditions need to be established for each line based on our previously established protocol 4 ...
-
No products found
because this supplier's products are not listed.
S.M. Hetzer, et al.,
bioRxiv - Neuroscience 2023
Quote:
Fluoro-Jade B (FJ-B; Histo-Chem, Jackson, AR; CAT# 1FJB), a marker for degenerating neurons and axons,(Schmued and Hopkins ...
-
No products found
because this supplier's products are not listed.
Charles B. Reilly, et al.,
bioRxiv - Microbiology 2024
Quote:
... B.1.617.2 (delta) and B.1.1.28 (gamma)) were obtained from Cellecta Inc and B.1.529 (omicron ...
-
No products found
because this supplier's products are not listed.
Amit Rahi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... followed by incubation for 5 min and intermittent washing with 3 chamber volumes of buffer B: PLL PEG biotin (0.1 mg ml-1, Susos, AG), Streptavidin (0.625 mg ml-1 ...
-
No products found
because this supplier's products are not listed.
Yu Ning, et al.,
bioRxiv - Microbiology 2020
Quote:
... Itraconazole (ITZ) and amphotericin B (Amp B) were purchased from LKT Laboratories, Inc ...
-
No products found
because this supplier's products are not listed.
K. Saini, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... (3Helix, Inc., B-CHP) and fluorescent Streptavidin conjugate Alexa-594 (Thermofisher -S11227 ...
-
No products found
because this supplier's products are not listed.
Anna Stier, et al.,
bioRxiv - Cell Biology 2022
Quote:
... or Aurora B (SignalChem) kinases ...
-
No products found
because this supplier's products are not listed.
Zixuan Liu, et al.,
bioRxiv - Molecular Biology 2022
Quote:
A Cell Counting Kit-8 (CCK-8) assay (M4839, AbMole) was used to analyze cell viability ...
-
No products found
because this supplier's products are not listed.
Pooja Gupta, et al.,
bioRxiv - Biochemistry 2021
Quote:
... An initial crystallization condition was identified I the Wizards Classic 3&4 crystallisation screen (Rigaku), well F2 (40% PEG400 ...
-
No products found
because this supplier's products are not listed.
Sang Dang Huynh, et al.,
bioRxiv - Plant Biology 2023
Quote:
... supplemented with hygromycin B (PhytoTechnology Laboratories) at a final concentration of 50 µg/ml ...
-
No products found
because this supplier's products are not listed.
Maryann P. Platt, et al.,
bioRxiv - Microbiology 2022
Quote:
... then spotted on nitrocellulose membrane alongside serotype 4 capsular polysaccharide 3-6 μg (SSI Diagnostica cat. 76855). The membrane was then blocked with 5% BSA in TBS with 0.05% Tween-20 and probed overnight with anti-pneumococcus capsular antibody (1:500 ...
-
No products found
because this supplier's products are not listed.
Erin M. Euliano, et al.,
bioRxiv - Bioengineering 2024
Quote:
... 2 equivalents of 4-((6-Amino-2-(2-methoxyethoxy)-8-oxo-7,8-dihydro-9H-purin-9-yl)methyl)benzoic acid (Ambeed, Arlington Heights, IL), also known as 1V209 ...
-
No products found
because this supplier's products are not listed.
Carla Merino, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
4-(Methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) was obtained from LGC-Dr Ehrenstorfer (LGC Standards, Barcelona, Spain) and 4-Hydroxy-4-(3-pyridyl)-butyric acid (HPBA ...
-
All viral vectors
Cat# KC30500,
ViroMag 200µL + Magnetic Plate MF10000, USD $657.00/KIT
Ask
Zeyang Shen, et al.,
bioRxiv - Genomics 2021
Quote:
... 2.5 μl/ml lentiblast B (OZ Biosciences) and 8 μg/ml polybrene (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Mariana Nunes, Natália Madeira, Rosalina Fonseca,
bioRxiv - Neuroscience 2023
Quote:
... 5 μM (0.01% DMSO) Cytochalasin-B (TargetMol) 0,5 μM (0.01% DMSO) ...
-
No products found
because this supplier's products are not listed.
Seungjoon Kim, et al.,
bioRxiv - Neuroscience 2020
Quote:
... rabbit polyclonal anti-cholecystokinin-8 (Immunostar), mouse monoclonal anti-GAD67 (clone 1G10.2 ...
-
No products found
because this supplier's products are not listed.
Joshua A. Broussard, et al.,
bioRxiv - Cell Biology 2021
Quote:
... mouse U100 anti-desmocollin 1a/b (Progen, 65192); mouse anti-vinculin (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Emily A Wheeler, et al.,
bioRxiv - Immunology 2023
Quote:
... and Factor B were purchased from Complement Technologies.
-
No products found
because this supplier's products are not listed.
Yanan Yang, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 8 ng/mL Cholera Toxin (CELL technologies), 5 ng/mL insulin (CELL technologies) ...
-
No products found
because this supplier's products are not listed.
Kunal Sharma, et al.,
bioRxiv - Microbiology 2021
Quote:
... the bladder-chip was attached to an adhesive conductive surface followed by coating with a 3 – 4 nm thick layer of gold palladium metal (Quorum Q Plus, Quorum Technologies). Images of the cells were captured using a field emission scanning electron microscope (Merlin ...
-
No products found
because this supplier's products are not listed.
Yang Li, et al.,
bioRxiv - Neuroscience 2021
Quote:
RNA was extracted from mouse brain lysates (mixture of 3∼4 mouse brains for each sample) using RNAprep pure Tissue Kit (Tiangen, DP431). cDNA was synthesized using HiScript II 1st Strand cDNA Synthesis Kit (Vazyme ...
-
No products found
because this supplier's products are not listed.
Janani Ramachandran, et al.,
bioRxiv - Developmental Biology 2023
Quote:
Differential SMARCC1 binding between E11.5 (40-43s) control (Gli3+/+; n=3) and Gli3-/- (n=4) samples was conducted using an E.coli spike-in (EpiCypher 18-1401) of 0.125ng/sample ...
-
No products found
because this supplier's products are not listed.
Tulika Singh, et al.,
bioRxiv - Immunology 2021
Quote:
B-LCLs were expanded in CELLine bioreactor flasks (Wheaton) following the manufacturer’s recommendations ...
-
No products found
because this supplier's products are not listed.
Lise Hunault, et al.,
bioRxiv - Microbiology 2023
Quote:
... anti-toxin B biotinylated antibody (BBI solutions, Madison, WI) followed by high sensitivity Streptavidin-HRP conjugate (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Jamie L. Marshall, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 5′-CE (b-cyanoethyl) phosphoramidites were purchased from Glen Research and were dissolved in anhydrous acetonitrile to obtain a concentration of 0.1M ...
-
No products found
because this supplier's products are not listed.
Tyler C. Detomasi, et al.,
bioRxiv - Genetics 2022
Quote:
... 3 mM of chitooligosaccharides (DP 3-6) (Megazyme, Wicklow, Ireland) were treated with 0.12 mg/mL of ChitO (Gecco Biotech ...
-
No products found
because this supplier's products are not listed.
Barbara Costa, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 8 bp single-index NEXTflex DNA barcodes (Bioo Scientific) were used ...
-
No products found
because this supplier's products are not listed.
Tess Cherlin, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... 8 x 25 Capillary Cartridge (Protein Simple #SM-W004). Primary antibodies ...
-
No products found
because this supplier's products are not listed.
John DeSisto, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... FGF and PDGF A/B at 20 ng/μL (Shenandoah Biotechnology). Cells were passaged as required by trituration to break up the neurospheres and replacement of the medium.
-
No products found
because this supplier's products are not listed.
Ji Zhang, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... Sample was combined with Biomix B and BirA (as per Avidity protocol) and incubated at 4°C for 14 hours ...
-
No products found
because this supplier's products are not listed.
Avirup Malla, Suvroma Gupta, Runa Sur,
bioRxiv - Cancer Biology 2023
Quote:
... Caspase 3 activity was measured by a caspase-3 activity assay kit (Elabscience) following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Sara Abdulkader, John Gigg,
bioRxiv - Animal Behavior and Cognition 2024
Quote:
Training took place in 8 operant chambers (Campden instruments Ltd, UK), each placed inside a ventilated and sound-attenuating box ...
-
No products found
because this supplier's products are not listed.
Snježana Kodba, et al.,
bioRxiv - Cell Biology 2024
Quote:
... one well of an 8-well Ibidi chambers (IBI Scientific #80807) was coated with 10 mg/mL Laminin (Sigma ...
-
No products found
because this supplier's products are not listed.
Alvina I. Khamidullina, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Primers CDKN1B-forv 5’-attagctagcATGTCAAACGTGCGAGTGTCTAA-3’ and CDKN1B-rev 5’-taatggatccTTACGTTTGACGTCTTCTGAGGC-3’ (Evrogen, Moscow, Russia) containing NheI and BamHI restriction sites were used for amplification ...
-
No products found
because this supplier's products are not listed.
Susanne Wiemann, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 3 % goat serum (Dianova, Hamburg, Germany), and 0.5 % Triton™-X-100 (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Shanshan Wang, et al.,
bioRxiv - Neuroscience 2020
Quote:
Brains were submerged in Golgi-Cox solution A + B (FD Neurotechnologies Inc., Ellicot City, Maryland) for 8 days followed by solution C for 4 days at room temperature ...
-
No products found
because this supplier's products are not listed.
Blanca V. Rodriguez, et al.,
bioRxiv - Immunology 2023
Quote:
... with the “Mix” mode selected at a speed of 8 rpm (Benchmark Scientific Roto-Therm Plus Incubated Rotator ...
-
No products found
because this supplier's products are not listed.
Daniel Pölöske, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Ba/F3 cells were grown in the presence of 1 ng/mL murine IL-3 (mIL-3, Immunotools). Mycoplasma contamination was regularly excluded using the MycoAlert mycoplasma detection kit (Lonza Group AG ...
-
No products found
because this supplier's products are not listed.
Csaba Matta, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... anti-MMP-3 (Aviva Systems Biology ARP42042_P050), anti-MMP-13 (Aviva Systems Biology ARP56350_P050) ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
Charles E. Norton, et al.,
bioRxiv - Physiology 2020
Quote:
... and audible baseline monitor (model ABM-3, WPI) as previously described27 ...
-
No products found
because this supplier's products are not listed.
Vilma Väänänen, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... Equal amounts of solutions A (Enhancer) and B (Activator) of the kit (GoldEnhance for LM, 2112-28ML, Nanoprobes) were mixed and left to incubate for 10 minutes before addition of solutions C (Initiator) ...
-
No products found
because this supplier's products are not listed.
Augusto Cesar Hunt-Serracin, et al.,
bioRxiv - Microbiology 2019
Quote:
... 4 g of Deoxyribonucleic Acid (Spectrum Chemicals), 5.9 mg diethylene triamine pentaacetic acid (DTPA) ...
-
No products found
because this supplier's products are not listed.
Zijun Sun, Thomas C. Südhof,
bioRxiv - Neuroscience 2020
Quote:
... fetal bovine serum (ATLANTA Biological; final concentration = 2-3%) were added to the culture medium ...
-
No products found
because this supplier's products are not listed.
Astrid Kollewe, et al.,
bioRxiv - Biochemistry 2021
Quote:
... manually packed 11 cm (AP-MS) or 23 cm (csBN-MS) with ReproSil-Pur 120 ODS-3 (C18; particle size 3 µm; Dr. Maisch HPLC, Germany) and electrosprayed (2.3 kV ...
-
No products found
because this supplier's products are not listed.
Uwe Schwartz, et al.,
bioRxiv - Microbiology 2023
Quote:
... 4 hpi using TRI Reagent (Molecular Research Center, Inc.). Two time series sets of total RNA were prepared from two independent infections ...
-
No products found
because this supplier's products are not listed.
Thomas R. Gawriluk, et al.,
bioRxiv - Immunology 2019
Quote:
... one of the 8 mm biopsies was placed into 10% (v/v) neutral buffered formalin (American MasterTech, McKinney, TX) overnight ...