1 - 50 of 742
suppliers found for
8 Chloro 2 3 4 5 tetrahydropyrido 3 2 f 1 4 oxazepine
» view 10000+ matched products-
MedChemExpress Sponsored
Cat# HY-16679-10 mM * 1 mL, 10 mM * 1 mL, USD $462.0 Ask
-
Roche
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2020Quote: ... 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ... -
Millipore Sigma
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2021Quote: ... 5-Bromo-4-Chloro-3-Indolyl-phosphate (BCIP, Sigma B8503) was used as the chromogenic substrate. -
Thermo Fisher
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... and 0.175 g/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Invitrogen). Alkaline phosphatase staining reaction was proceeded o/n at RT ... -
Promega
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2022Quote: SJ-GBM2 and SF8628 cells were used to determine if reducing WDR82 through inducible knockdown affected cell viability 1×104 cells/100μl were plated in 96-well plates with complete cell culture medium with or without Dox (2μg/ml), and subjected to 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, Promega) assay. -
Tocris
No products found because this supplier's products are not listed.bioRxiv - Physiology 2021Quote: ... resiniferatoxin and 4-(3-Chloro-2-pyridinyl)-N-[4-(1,1-dimethylethyl)phenyl]-1-piperazinecarboxamide (BCTC) were purchased from Tocris Bioscience or Adooq Bioscience and stock solutions were prepared in EtOH at 1 M and 100 mM ... -
abcam
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... 4-(3-(cyclopentyloxy)-4-methoxyphenyl)pyrrolidin-2-one (rolipram; Abcam); 4-[(2S)-2-[(5-isoquinolinylsulfonyl)methylamino]-3-oxo-3-(4-phenyl-1-piperazinyl)propyl] phenyl isoquinolinesulfonic acid ester (KN-62 ... -
Avanti Polar Lipids
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2022Quote: ... 4 μM lipid vesicles (Avanti Polar Lipids PS:PC:PE 3:2:5), and FV (0 ... -
Qiagen
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2021Quote: ... si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’; Qiagen), si-XPO1 (5’-UGUGGUGAAUUGCUUAUAC-3’). -
Addgene
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: ... sgRNAs targeting RABIF (sg #2: 5’-GAGCGAGTTAGTGTCAGCCGAGG-3’ and sg #4 5’-AGCGAGTTAGTGTCAGCCGAGGG-3’) were cloned in lentiCRISPRv2 (Addgene #52961). MDA-MB-231 cells were infected with the corresponding lentiviruses and selected with 1μg/ml puromycin (Thermo Fisher Scientific). -
Santa Cruz
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2017Quote: ... Canada) and Methyl 3-[[2-[4-(2-adamantyl) phenoxy] acetyl]amino]-4-hydroxybenzoate (HIF-1α inhibitor) was obtained from Santa Cruz Biotechnology (California ... -
Gold Biotechnology
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2018, published in The Plant Cell doi: 10.1105/tpc.19.00150Quote: ... 0.3% Triton X-100 and 2 mM 5-Bromo-4-chloro-3-indoxyl-beta-D-glucuronide cyclohexylammonium (X-gluc) (Gold Biotechnology, USA)) on multi-well plates ... -
Takara Bio
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... 40 μg mL−1 5-Bromo-4-Chloro-3-Indolyl-beta-D-Galactosidase (X-gal, Takara Bio), and 500 μM isopropyl beta-D-1-thiogalactopyranoside (IPTG ... -
Calbiochem
No products found because this supplier's products are not listed.Cited in 14-3-3β paralog is inhibited by acetylation during differentiation to the osteogenic lineagebioRxiv - Cell Biology 2019Quote: ... 5 mM MgCl2 reaction buffer containing 0.015% w/v 5-bromo-4-chloro-3-indolyl phosphate-BCIP-(Calbiochem) substrate and 0.03% w/v nitro blue tetrazolium-NBT-(BDH Chemicals Ltd. ... -
Bio-Rad
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2020Quote: ... Membranes were washed three times with 1X PBS for 5 min and developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in alkaline phosphatase buffer (Bio-Rad). -
New England Biolabs
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2021Quote: ... The 3’ linker (5′-rAppGTGTCAGTCACTTCCAGCGG-3’, Dharmacon) was added using T4 RNA Ligase 2 (NEB, M0242S), followed by the PNK (NEB ... -
Cell Signaling Technology
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2019, published in eLife doi: 10.7554/eLife.50523Quote: ... stained in 1mg/ml 5-Bromo-4-chloro-3-indolyl β-D-galactopyranoside (X-gal, Cell Signaling) pH of 5.9-6.1 overnight at 37C ... -
World Precision Instruments
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2021Quote: For GBA quantification (n=5 for 4 WPI, n=3 for 8 WPI), the surface function of the Imaris software was used to select only GFP-positive cells by appropriately adjusting the number of voxels as well as the intensity of the GFP channel in the threshold tab ... -
Becton, Dickinson and Company
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... 8 color (4-2-2) configuration (BD Bioscience, Heidelberg, Germany). The system automatically adjusts spillover values for the compensation of standard fluorochromes ... -
Merck
No products found because this supplier's products are not listed.Cited in P2RX7 inhibition reduces breast cancer induced osteolytic lesions - implications for bone metastasisbioRxiv - Cancer Biology 2022Quote: ... The cells were then stimulated with 100μM 2’(3’)-O-(4-Benzoylbenzoyl) adenosine-5’-triphosphate (BzATP; Merck Life Sciences, Gillingham, UK) to activate the P2RX7 ... -
Corning
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... cells were seeded at 2–3 × 10~4 cells on 6.5 mm Transwell membranes (Corning) coated with 30 μg/mL Bovine type I collagen solution and cultured in 2x P/S (200 U/mL Pen/Strep DMEM-low glycose (Sigma-Aldrich ... -
Cayman Chemical
No products found because this supplier's products are not listed.Cited in Influenza A matrix protein M1 induces lipid membrane deformation via protein multimerizationbioRxiv - Biophysics 2019, published in Bioscience Reports doi: 10.1042/BSR20191024Quote: ... 2-(4-(3-(4-acetyl-3-hydroxy-2-propylphenoxy) propoxy) phenoxy acetic acid (PHE) was purchased from Cayman Chemical (Ann Arbor, MI, USA). 10-fold concentrated phosphate buffer (PBS ... -
Vector Labs
No products found because this supplier's products are not listed.Cited in Variable branching characteristics of peripheral taste neurons indicates differential convergencebioRxiv - Neuroscience 2021Quote: ... before incubating overnight at room temperature in 0.1 M Tris-HCl (pH 9.5) containing nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl-phosphate at the recommended concentrations (Vector Laboratories). After washing in PBS and postfixing in 4% PFA ... -
Agilent
No products found because this supplier's products are not listed.Cited in Spermatoproteasome-deficient mice are proficient in meiotic DNA repair but defective in meiotic exitbioRxiv - Cell Biology 2018Quote: ... with primers flanking exons 1 and intron 1 (Primer F 5-CTTCTCGGTATGACAGGGCAATC-3’ and R 5’-ACTCTACCTCCACTGCCAACCTG-3’) and either direct sequenced or subcloned into pBlueScript (Stratagene) followed by Sanger sequencing ... -
R&D Systems
No products found because this supplier's products are not listed.Cited in DNAJB1-PRKACA in HEK293T cells induces LINC00473 overexpression that depends on PKA signalingbioRxiv - Cancer Biology 2021Quote: Cells were grown to 70% confluent in 24-well plates prior to treatment with N-[2-[[3-(4-Bromophenyl)-2-propenyl]amino]ethyl]-5-isoquinolinesulfonamide dihydrochloride (H89; R&D Systems) or 3-(1,3-Benzodioxol-5-ylmethylene)-2-oxo-1-pyrrolidinecarboxaldehyde (KNK437 ... -
Electron Microscopy Sciences
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2021Quote: ... 2% and 3% OsO4 (prepared from 2 mL 4% osmium tetroxide solution, Electron Microscopy Sciences, Hatfield, PA) -
Polysciences
No products found because this supplier's products are not listed.bioRxiv - Genetics 2019Quote: ... at a weight ratio of 4:3:2 using 54 µL PEI (Polysciences, 24765-1, 1 µg/µl). We changed the medium after 4-6 hours of incubation at 37 °C and 5% CO2 ... -
Charles River Labs
No products found because this supplier's products are not listed.bioRxiv - Bioengineering 2019Quote: ... Four New Zealand white male rabbits (Charles River, 3 to 6 months old, 2 to 4 kg) were housed in a 12:12 h light-dark cycle ... -
BioLegend
No products found because this supplier's products are not listed.bioRxiv - Genomics 2018Quote: ... unconjugated reagents from BioLegend (see Supplementary Tables 1, 3 & 4) and were covalently and irreversibly conjugated to barcode oligos by iEDDA-click chemistry as previously described13. -
The Jackson Laboratory
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: ... Initial experiments were conducted using both male and female C57BL/6J mice (Jackson Labs, 3-4 months old, Figs. 1-2). Female mice were used for all subsequent experiments ... -
GE Life Sciences
No products found because this supplier's products are not listed.bioRxiv - Animal Behavior and Cognition 2020Quote: ... CG42797EcoRI_F: 5’-CCGgaattcATGGAGCCACCAGCT-3’ and CG42797XhoI_Nterm_R: 5’-CCGctcgagTCATTCGCTGGGCTGC-3’ and cloned by enzymatic digestion into a pGEX6P1(GE Healthcare). -
SouthernBiotech
No products found because this supplier's products are not listed.bioRxiv - Immunology 2019, published in PLOS ONE doi: 10.1371/journal.pone.0226396Quote: ... were detected with bromo-4-chloro-3-indolyl phosphate substrate (Southern Biotech). -
VWR
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2019, published in Infection and Immunity doi: 10.1128/iai.00019-19Quote: ... The membranes were washed 3 times in TBST for 15 minutes each and blots were developed with BCIP/NBT (5-bromo-4-chloro-3-indoyl-phosphate/nitro blue tetrazolium) color development substrate (VWR). -
Lonza
No products found because this supplier's products are not listed.Cited in HMGB1 coordinates SASP-related chromatin folding and RNA homeostasis on the path to senescencebioRxiv - Genomics 2020Quote: ... donors (passage 2-3; Lonza) were continuously passaged to replicative exhaustion in complete Endopan-2 supplemented with 2% FBS under 5% CO2 ... -
Jackson ImmunoResearch
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... samples were further statically incubated for 1 h at 4°C with APC-conjugated polyclonal goat-anti-human IgG F(ab’)2 antibody (Jackson immunoresearch, 1:500). Fab fragments were detected with Alexa Fluor 647 conjugated goat-anti-human-kappa F(ab’)2 antibody (Southern Biotech ... -
Jena Bioscience
No products found because this supplier's products are not listed.Cited in Mechanism of actin-dependent activation of nucleotidyl cyclase toxins from bacterial human pathogensbioRxiv - Biochemistry 2021Quote: ... 2 mM 3’-deoxyguanosine-5’-triphosphate (3’-dGTP, Jena Bioscience) and 4 mM MgCl2 ... -
PerkinElmer
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ... -
Invivogen
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019Quote: ... 2’,3’-cGAMP (Invivogen) at 10 μg/mL ... -
Leica
No products found because this supplier's products are not listed.Cited in ASCL1 drives induction of a transitory cell state required for repair of the injured neonatal brainbioRxiv - Developmental Biology 2020Quote: ... Image stacks were obtained every 3-4 minutes for 6-8 hours using a LSM880 (Leica) with an environmental chamber (37°C with 5% CO2) ... -
Peprotech
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... recombinant mouse IL-4 (Peprotech; 2 ng/ml) was added to the cultures ... -
3M
No products found because this supplier's products are not listed.Cited in Expression analysis of Huntington disease mouse models reveals robust striatum disease signaturesbioRxiv - Neuroscience 2022Quote: The proteomics signature had 4 validation data sets: R6/2 mice aged 2 months (R6/2 2M) or 3 months (R6/2 3M) from PRIDE experiment PXD013771 ... -
Alfa Aesar
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2020Quote: ... MTT (3-[4, 5- dimethyl thiazol-2-yl]-2,5 diphenyl tetrazolium bromide) (Alfa Aesar Chemicals Co. Ltd. Shanghai, China), fetal bovine serum (FBS ... -
Phenomenex
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2019Quote: ... 3 μm (2.1 × 150 mm) column with Security Guard (4 × 2 mm) at 40°C (Phenomenex, Cheshire, UK). The standards and the samples (5 μl injection volume ... -
Stemcell Technologies
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2021Quote: ... in a 3:4 mixture of media (StemCell Technologies # 05620) and Matrigel (BD Bioscience CB-40324) ... -
anatrace
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2021Quote: ... 3-([3-cholamidopropyl]dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, Anatrace) was added to the sample (8 mM final) ... -
Beckman
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... CD38 APC-AF700 (clone LS198-4-3; Beckman Coulter), CD19 APC-Cy7 (clone SJ25C1 ... -
Olympus
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2018, published in Nature Methods doi: 10.1038/s41592-019-0581-xQuote: ... Wide-field images (Fig.1, 2, 3, 5, 6) were acquired with a 4× objective (Olympus XLFluor 4x/340a); high-resolution images (Fig ... -
Biosearch Technologies
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2017, published in mBio doi: 10.1128/mBio.01503-17Quote: ... Reference viruses were detected by a probe targeting the same region but with 10 silent mutations (5’-TCCGAACTACTGCAACCCCAAGTG-3’) and labeled with 5’ Quasar 670 and 3’ black hole quencher 2 (BHQ-2) (Biosearch Technologies, Petaluma, CA). RNA copy number was calculated by reference to an RNA standard generated by in vitro transcription of the corresponding MHV A fragment ... -
Illumina
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ... -
Quantifoil Micro Tools
No products found because this supplier's products are not listed.Cited in Contour, a semi-automated segmentation and quantitation tool for cryo-soft-X-ray tomographybioRxiv - Cell Biology 2021Quote: 3 mm gold EM grids with a holey carbon film (R 2/2, 200 mesh; Quantifoil Cat no ... -
Biosynth International
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2018, published in Developmental Biology doi: 10.1016/j.ydbio.2019.02.014Quote: ... and 5-bromo-4-chloro-3-indolyl-phosphate (BCIP, Biosynth) at room temperature until dark purple precipitate deposited revealing the areas of gene transcription ...