-
No products found
because this supplier's products are not listed.
Clara R. Stelman, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ...
-
No products found
because this supplier's products are not listed.
Zongyu Li, et al.,
bioRxiv - Physiology 2023
Quote:
... glycogen phosphorylase was inhibited by IV (jugular vein) injection of 1-(3-(3-(2-Chloro-4,5-difluorobenzoyl)ureido)-4-methoxyphenyl)-3-methylurea (Sigma, 5 mg/kg) one hour prior to the start of a tracer infusion ...
-
No products found
because this supplier's products are not listed.
Jakub Netolicky, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 7-Chloro-4-hydroxy-3-(3-phenoxy)phenyl-2(1H)-quinolinone (L-701-324; Tocris); (R)-3-(2-Carboxypiperazin-4-yl)propyl-1-phosphonic acid ((R)-CPP ...
-
No products found
because this supplier's products are not listed.
Francis Ledesma, et al.,
bioRxiv - Bioengineering 2023
Quote:
... 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium (WST-8) was purchased from ThermoFisher Scientific.
-
No products found
because this supplier's products are not listed.
Nitin Wadhwani, et al.,
bioRxiv - Cancer Biology 2022
Quote:
SJ-GBM2 and SF8628 cells were used to determine if reducing WDR82 through inducible knockdown affected cell viability 1×104 cells/100μl were plated in 96-well plates with complete cell culture medium with or without Dox (2μg/ml), and subjected to 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, Promega) assay.
-
No products found
because this supplier's products are not listed.
Pojeong Park, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 4-(3-(cyclopentyloxy)-4-methoxyphenyl)pyrrolidin-2-one (rolipram; Abcam); 4-[(2S)-2-[(5-isoquinolinylsulfonyl)methylamino]-3-oxo-3-(4-phenyl-1-piperazinyl)propyl] phenyl isoquinolinesulfonic acid ester (KN-62 ...
-
No products found
because this supplier's products are not listed.
Dougald M. Monroe, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 4 μM lipid vesicles (Avanti Polar Lipids PS:PC:PE 3:2:5), and FV (0 ...
-
No products found
because this supplier's products are not listed.
Liang Wang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
No products found
because this supplier's products are not listed.
Joel Johnson George, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... X-gal (5-Bromo-4-chloro-3-indoxyl-beta-D-galactopyranoside, Goldbio) was dissolved in dimethylformamide at 50 mg/ml ...
-
No products found
because this supplier's products are not listed.
Valeria Scagliotti, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... and 5-Bromo-4-chloro-3-indolyl phosphate disodium salt (BCIP, 11383221001, Merck-SIGMA). Sections were mounted using DPX (6522 ...
-
No products found
because this supplier's products are not listed.
Konstadinos Moissoglu, et al.,
bioRxiv - Cell Biology 2020
Quote:
... sgRNAs targeting RABIF (sg #2: 5’-GAGCGAGTTAGTGTCAGCCGAGG-3’ and sg #4 5’-AGCGAGTTAGTGTCAGCCGAGGG-3’) were cloned in lentiCRISPRv2 (Addgene #52961). MDA-MB-231 cells were infected with the corresponding lentiviruses and selected with 1μg/ml puromycin (Thermo Fisher Scientific).
-
No products found
because this supplier's products are not listed.
Olivier Da Ines, et al.,
bioRxiv - Genetics 2022
Quote:
... 2 mM X-Gluc (5-bromo-4-chloro-3-indolyl-ß-D-glucuronic acid; Biosynth), dissolved in N,N-dimethylformamide) ...
-
No products found
because this supplier's products are not listed.
Justin E. Silpe, et al.,
bioRxiv - Microbiology 2021
Quote:
... 40 μg mL−1 5-Bromo-4-Chloro-3-Indolyl-beta-D-Galactosidase (X-gal, Takara Bio), and 500 μM isopropyl beta-D-1-thiogalactopyranoside (IPTG ...
-
No products found
because this supplier's products are not listed.
Ismail Dahmani, Kai Ludwig, Salvatore Chiantia,
bioRxiv - Biophysics 2019
Quote:
... 2-(4-(3-(4-acetyl-3-hydroxy-2-propylphenoxy) propoxy) phenoxy acetic acid (PHE) was purchased from Cayman Chemical (Ann Arbor, MI, USA). 10-fold concentrated phosphate buffer (PBS ...
-
No products found
because this supplier's products are not listed.
Julian J A Hoving, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... AKT 1/2/3 (Santa Cruz), Slit2 (Abcam ab134166 ...
-
No products found
because this supplier's products are not listed.
Anne D. Villela, et al.,
bioRxiv - Microbiology 2020
Quote:
... Membranes were washed three times with 1X PBS for 5 min and developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in alkaline phosphatase buffer (Bio-Rad).
-
No products found
because this supplier's products are not listed.
G. Siano, et al.,
bioRxiv - Neuroscience 2023
Quote:
... mRNA Magnetic Isolation Module and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1/2/3/4) following the manufacturer’s instructions (New England Biolabs). Quantification and quality checked of libraries was done using an Bioanalyzer 2100 instrument and DNA 7500 kit (Agilent Technologies) ...
-
No products found
because this supplier's products are not listed.
Christine Krammer, et al.,
bioRxiv - Immunology 2021
Quote:
... 8 color (4-2-2) configuration (BD Bioscience, Heidelberg, Germany). The system automatically adjusts spillover values for the compensation of standard fluorochromes ...
-
No products found
because this supplier's products are not listed.
Yesica R Frontini-Lopez, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5 mM MgCl2 reaction buffer containing 0.015% w/v 5-bromo-4-chloro-3-indolyl phosphate-BCIP-(Calbiochem) substrate and 0.03% w/v nitro blue tetrazolium-NBT-(BDH Chemicals Ltd. ...
-
No products found
because this supplier's products are not listed.
Chunmei Li, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... stained in 1mg/ml 5-Bromo-4-chloro-3-indolyl β-D-galactopyranoside (X-gal, Cell Signaling) pH of 5.9-6.1 overnight at 37C ...
-
No products found
because this supplier's products are not listed.
Teresa Neuwirth, et al.,
bioRxiv - Immunology 2024
Quote:
... Each patient was also stained with one of TotalSeq™-C0251/2/3/4 Antibody (Biolegend, Cat: 394661/3/5/7, 1:100) for sample multiplexing ...
-
No products found
because this supplier's products are not listed.
Alexia Polissidis, et al.,
bioRxiv - Neuroscience 2021
Quote:
For GBA quantification (n=5 for 4 WPI, n=3 for 8 WPI), the surface function of the Imaris software was used to select only GFP-positive cells by appropriately adjusting the number of voxels as well as the intensity of the GFP channel in the threshold tab ...
-
No products found
because this supplier's products are not listed.
Yun Deng, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... with 5-bromo-4-chloro-3-indolyl-phosphate nitro blue tetrazolium staining (Vector Laboratories, Burlingame, CA, USA). 10 ∼ 30 embryos were used for each probe ...
-
No products found
because this supplier's products are not listed.
Emily J. Talbot, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 4 µM digitonin) with or without 7 µM 2’,3’-cGAMP (Invivogen). Cells were further washed in PBS and incubated in culture medium until collection ...
-
No products found
because this supplier's products are not listed.
Sara F. Costa, et al.,
bioRxiv - Microbiology 2023
Quote:
... with 100 μg/mL 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal, VWR), or with 0.1 μM CdCl2 (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Annika Ullrich, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... and the plasmids for G protein activation (the ratio of receptor/Gα/Gβ/Gγ was 4/1/2/8) using linear polyethyleneimine (PEI, Polysciences, 3:1 PEI:DNA ratio) (65 ...
-
No products found
because this supplier's products are not listed.
Sebastian Ströh, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 2% and 3% OsO4 (prepared from 2 mL 4% osmium tetroxide solution, Electron Microscopy Sciences, Hatfield, PA)
-
No products found
because this supplier's products are not listed.
Chang-Bin Jing, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
No products found
because this supplier's products are not listed.
Renée M. van der Sluis, et al.,
bioRxiv - Immunology 2021
Quote:
... cells were seeded at 2–3 × 10~4 cells on 6.5 mm Transwell membranes (Corning) coated with 30 μg/mL Bovine type I collagen solution and cultured in 2x P/S (200 U/mL Pen/Strep DMEM-low glycose (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Jesse E Bucksot, et al.,
bioRxiv - Bioengineering 2019
Quote:
... Four New Zealand white male rabbits (Charles River, 3 to 6 months old, 2 to 4 kg) were housed in a 12:12 h light-dark cycle ...
-
No products found
because this supplier's products are not listed.
Mai Takenaka, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... riluzole (supply name: 2-amino-6-(trifluoromethyl)benzothiazole) and 4-chloro-3-ethylphenol (4-CEP) from Tokyo Chemical Industry (Tokyo, Japan), and 4-chloro-m-cresol (4-CMC ...
-
No products found
because this supplier's products are not listed.
Marinelle Rodrigues, et al.,
bioRxiv - Microbiology 2023
Quote:
... 2 gr 4-Chloro-DL-phenylalanine (Alfa Aesar, cat. A13323), 15 gr agar per 1 L of media) ...
-
No products found
because this supplier's products are not listed.
Stephanie S. Kim, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Cells were grown to 70% confluent in 24-well plates prior to treatment with N-[2-[[3-(4-Bromophenyl)-2-propenyl]amino]ethyl]-5-isoquinolinesulfonamide dihydrochloride (H89; R&D Systems) or 3-(1,3-Benzodioxol-5-ylmethylene)-2-oxo-1-pyrrolidinecarboxaldehyde (KNK437 ...
-
No products found
because this supplier's products are not listed.
Antonio Marino, et al.,
bioRxiv - Systems Biology 2023
Quote:
... 4 3 2.0 mm SecurityGuard (Phenomenex) cartridge as a guard column ...
-
No products found
because this supplier's products are not listed.
Ewan Phillip Ramsay, et al.,
bioRxiv - Biochemistry 2020
Quote:
... WH1-2 (922μM) and WH3-4 (3691μM) were passed through a Bio SEC-3 HPLC column (Agilent) at 0.2ml/min in 50mM Tris-HCl pH 7.5 ...
-
No products found
because this supplier's products are not listed.
Sladjana Skopelja-Gardner, et al.,
bioRxiv - Immunology 2020
Quote:
... Initial experiments were conducted using both male and female C57BL/6J mice (Jackson Labs, 3-4 months old, Figs. 1-2). Female mice were used for all subsequent experiments ...
-
No products found
because this supplier's products are not listed.
Valentina Fajner, et al.,
bioRxiv - Animal Behavior and Cognition 2020
Quote:
... CG42797EcoRI_F: 5’-CCGgaattcATGGAGCCACCAGCT-3’ and CG42797XhoI_Nterm_R: 5’-CCGctcgagTCATTCGCTGGGCTGC-3’ and cloned by enzymatic digestion into a pGEX6P1(GE Healthcare).
-
No products found
because this supplier's products are not listed.
Rachael Gordon, et al.,
bioRxiv - Immunology 2019
Quote:
... were detected with bromo-4-chloro-3-indolyl phosphate substrate (Southern Biotech).
-
No products found
because this supplier's products are not listed.
John C. Obenauer, et al.,
bioRxiv - Neuroscience 2023
Quote:
The proteomics signature had 4 validation data sets: R6/2 mice aged 2 months (R6/2 2M) or 3 months (R6/2 3M) from PRIDE experiment PXD013771 ...
-
No products found
because this supplier's products are not listed.
Masahito Yamagata, Wenjun Yan, Joshua R. Sanes,
bioRxiv - Neuroscience 2020
Quote:
... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ...
-
No products found
because this supplier's products are not listed.
James Chen, et al.,
bioRxiv - Biophysics 2021
Quote:
... 3-([3-cholamidopropyl]dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, Anatrace) was added to the sample (8 mM final) ...
-
No products found
because this supplier's products are not listed.
Lulu Huang, et al.,
bioRxiv - Cell Biology 2024
Quote:
... BMP-2/4) (ERB medium)3 or adding 10 ng/ml human IL-22 (Peprotech) in WENRA4 (Wnt/ R-spondin1 ...
-
No products found
because this supplier's products are not listed.
Amoldeep S. Kainth, Hesheng Zhang, David S. Gross,
bioRxiv - Genetics 2024
Quote:
... then 1-NM-PP1 (4-amino-1-tert-butyl-3-(1’-naphthylmethyl)pyrazolo[3-4-d]pyrimidine) (Toronto Research Chemicals, Inc.; no. A603003) was added to a final concentration of 15 μM ...
-
No products found
because this supplier's products are not listed.
Biren M. Dave, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... differentiating cells were confluent again and split 1:3-1:4 into Step 2 differentiation medium: BrainPhys Neuronal Medium (STEMCELL Technologies, cat# 05790), 1X N2 ...
-
No products found
because this supplier's products are not listed.
Alexander Belyy, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 2 mM 3’-deoxyguanosine-5’-triphosphate (3’-dGTP, Jena Bioscience) and 4 mM MgCl2 ...
-
No products found
because this supplier's products are not listed.
Piyush Daga, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 4% (3-Aminopropyl)triethoxysilane(APTES)-treated and 2% glutaraldehyde-activated glass-bottom dishes (Ibidi) were used to cast polyacrylamide (PAA ...
-
No products found
because this supplier's products are not listed.
N. Sumru Bayin, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Image stacks were obtained every 3-4 minutes for 6-8 hours using a LSM880 (Leica) with an environmental chamber (37°C with 5% CO2) ...
-
No products found
because this supplier's products are not listed.
Paraskevi Athanasouli, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
No products found
because this supplier's products are not listed.
Lisanne de Vor, et al.,
bioRxiv - Microbiology 2021
Quote:
... samples were further statically incubated for 1 h at 4°C with APC-conjugated polyclonal goat-anti-human IgG F(ab’)2 antibody (Jackson immunoresearch, 1:500). Fab fragments were detected with Alexa Fluor 647 conjugated goat-anti-human-kappa F(ab’)2 antibody (Southern Biotech ...
-
No products found
because this supplier's products are not listed.
Yeon Soo Kim, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... shSIRT3_#4: 5’-TCACATTCTGTTGACTCTCCATACTCAGC-3’) in pRS vector (Origene, TR309432) were used to stably transfect OVCA433 cells (Supp ...