-
No products found
because this supplier's products are not listed.
Marcel E. Sayre, et al.,
bioRxiv - Neuroscience 2021
Quote:
... neural tissue was left to incubate for 2-3 days in primary antibody solution consisting of 1:250 mouse anti-TH (AB_572268; ImmunoStar; Hudson, WI) in 1% PBST with 1% NGS ...
-
No products found
because this supplier's products are not listed.
Vanessa R Povolo, et al.,
bioRxiv - Microbiology 2022
Quote:
... and xylan (2% w/v, Megazyme) were prepared with nanopure water and filter sterilized using 0.4 μm surfactant-free cellulose acetate filters (Corning) ...
-
LC Laboratories' Product Number O-2220 - Okadaic Acid, Free Acid (Halochondrine A), >98% - for...
Cat# O-2220, SKU# O-2220_1mg,
1 mg, $595.00
Ask
Jing Fan, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 2 µM Olaparib (LC laboratories, O-9201) and 20 nM BMN673 (Selleckchem ...
-
No products found
because this supplier's products are not listed.
Samantha A. Scott, Jingjing Fu, Pamela V. Chang,
bioRxiv - Microbiology 2023
Quote:
... and 4-chloro-DL-phenylalanine methyl ester hydrochloride (PCPA) were purchased from Neta Scientific. Pertussis toxin (PTx ...
-
No products found
because this supplier's products are not listed.
Matiss Maleckis, et al.,
bioRxiv - Bioengineering 2024
Quote:
... and 10 μM Hexakis (2, 2, 3, 3-tetrafluoropropoxy) phosphazene (Apollo Scientific Ltd., Cheshire, UK) as lock masses ...
-
No products found
because this supplier's products are not listed.
Hossein Mohammad-Beigi, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
Sulfo SASD (Sulphosuccinimidyl-2-(p-azidosalicylamido) ethyl-1,3-dithiopropionate) was purchased from G-biosciences. Dibenzocyclooctyne (DBCO)-Sulpho-NHS and DBCO-Sulpho-Cyanine5 were purchased form click chemistry tools and Genabioscience companies ...
-
No products found
because this supplier's products are not listed.
Héctor M Ramos-Zaldívar, et al.,
bioRxiv - Neuroscience 2024
Quote:
... or a carboxylic acid group (HS-PEG-COOH MW 5K, JenKem Technology, TX, USA) at the other ...
-
No products found
because this supplier's products are not listed.
Wenwen Tang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 14C-labeled arachidonic acid (2 μM, 14C-ARA, Moravek, MC364) or 14C-labeled oleic acid (1 μM ...
-
No products found
because this supplier's products are not listed.
Michal H. Kolář, et al.,
bioRxiv - Biophysics 2021
Quote:
The VemP constructs (VemP-1, VemP-2, and VemP-3) were synthesized by Biomatik using solid state synthesis at a 95% purity level ...
-
No products found
because this supplier's products are not listed.
Aude Noiret, Fabienne Aujard, Jeremy Terrien,
bioRxiv - Evolutionary Biology 2023
Quote:
... ref MS E-5100) and 8-hydroxy-2’-deoxyguanosine (“8-OHdG,” in ng.ml− 1; OxiSelectTM Oxidative DNA Damage Elisa kit, Cell Biolabs Inc., ref STA-320) were measured in duplicates from urine samples as indicators of the organisms’ response to environmental stress (Miller et al. ...
-
No products found
because this supplier's products are not listed.
Gab-Chol Choi, et al.,
bioRxiv - Bioengineering 2020
Quote:
... and bone morphogenetic protein 2 (BMP-2) (1:200, orb251474, Biorbyt) primary antibodies at 4°C ...
-
No products found
because this supplier's products are not listed.
Eric L. Van Nostrand, et al.,
bioRxiv - Genomics 2020
Quote:
... 3% Trichloroacetic acid (Glen Research) as the deblocking solution ...
-
No products found
because this supplier's products are not listed.
Rohit Singh Rawat, et al.,
bioRxiv - Neuroscience 2022
Quote:
... isolated from hypothalamus and PFC of F0 and F1 male mice was diluted in immunoprecipitation buffer and incubated with 2 μg 5-methyl cytosine antibody (A-1014; Epigentek) at 4°C overnight ...
-
No products found
because this supplier's products are not listed.
Platre Matthieu Pierre, et al.,
bioRxiv - Plant Biology 2022
Quote:
... The pellet was resuspended in 1 mL of immunoprecipitation buffer (50 mM Tris at pH 8, 150 mM NaCl, 1% Triton X-100) using a 2-mL potter (Wheaton), and was left on a rotating wheel for 30 min at 4°C ...
-
No products found
because this supplier's products are not listed.
Kushal Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
No products found
because this supplier's products are not listed.
Amanda R. Dicks, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... and sclerotome (3 days; 1 µM Wnt-C59, 2 µM purmorphamine [cat. num. 04-0009; Reprocell, Beltsville, MD]) into chondroprogenitor cells (6 days ...
-
No products found
because this supplier's products are not listed.
Varun Kamat, et al.,
bioRxiv - Cell Biology 2021
Quote:
... The perifusion system consisted of an 8-channel peristaltic pump (MiniPuls 2, Gilson, Middleton, WI) connected to a 6-port valve (Part # V-451 ...
-
No products found
because this supplier's products are not listed.
Marcus Griffiths, et al.,
bioRxiv - Plant Biology 2020
Quote:
... via tubing connected to the bottom of each chamber (3.17 mm ID tubing Ismatec SC0222-LT 2-Stop 0; Masterflex SC0223-LT Tygon; Masterflex Hose Barb Union 1/8”, Cole-Parmer Instrument Company LLC. ...
-
No products found
because this supplier's products are not listed.
Sumin Jang, Elias Gunmit, Hynek Wichterle,
bioRxiv - Developmental Biology 2022
Quote:
... ISL1/2 (Goat, 1:5000 Neuromics GT15051), MNX1 (Guinea pig ...
-
No products found
because this supplier's products are not listed.
Laura E. Burnett, et al.,
bioRxiv - Neuroscience 2024
Quote:
... PAG tissue was dissected using a 2 mm diameter biopsy punch (ID: 2 mm, OD: 3 mm, Fine Science Tools, 18035-02). Each purification was performed independently three times and samples were stored at -80 °C until further processing ...
-
No products found
because this supplier's products are not listed.
Michael Riffle, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... Desalting was performed with 8 μL of 0.1% formic acid plus 2% acetonitrile and the trap was subsequently brought online with a Self-Packed PicoFrit Column (New Objective part number PF360-75-10-N-5 ...
-
No products found
because this supplier's products are not listed.
Rui Sun, et al.,
bioRxiv - Systems Biology 2022
Quote:
... AKT1-2 inhibitor MK-2206 (Targetmol, 1032350-13-2), and everolimus (Targetmol ...
-
No products found
because this supplier's products are not listed.
NC Rodgers, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 2 μL of 1 mg/mL BSA (Boston BioProducts) was added to 38 μL of each top supernatant and pellet sample ...
-
No products found
because this supplier's products are not listed.
Andrew Barszczyk, et al.,
bioRxiv - Cell Biology 2023
Quote:
... alkaline phosphatase conjugated antibodies were detected colourometrically using BCIP/NBT (nitro-blue tetrazolium and 5- bromo-4-chloro-3’-indolyphosphate) Substrate Solution (#BE116.100ML; Bio Basic Canada Inc). For analysis of bands ...
-
No products found
because this supplier's products are not listed.
Yajie Wang, et al.,
bioRxiv - Plant Biology 2022
Quote:
... total RNAs isolated from the leaves of SC8 and mutant lines (#1, #2, #3, #4) using RNAplant Plus reagent (TianGen, Beijing, China) following the manufacturer’s instructions were reversed by using the reverse transcriptase kit (TaKaRa ...
-
No products found
because this supplier's products are not listed.
Robert Wimbish, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Silanized coverslips were incubated with a rat anti-tubulin antibody (8 μg/ml, YL1/2; Accurate Chemical & Scientific Corporation) for 5 minutes ...
-
No products found
because this supplier's products are not listed.
Cori K. Cahoon, et al.,
bioRxiv - Developmental Biology 2022
Quote:
The quantification of GFP::SYP-2 and mCherry::SYP-3 was performed using Imaris (Oxford Instruments) in combination with our whole gonad analysis ...
-
No products found
because this supplier's products are not listed.
Sen Yang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... all culture medium was replaced by 2-3 ml of Hibernate E low fluorescence buffer (BrainBits) supplemented with 2mM GlutaMAX™ to maintain the ambient pH environment.
-
No products found
because this supplier's products are not listed.
A. Schlör, et al.,
bioRxiv - Immunology 2022
Quote:
... 1 μg SARS-CoV-2 Spike protein (antibodies-online, ABIN6952734) per lane was applied onto a 4-12% SDS polyacrylamide gradient gel ...
-
No products found
because this supplier's products are not listed.
Peter Vandeberg, et al.,
bioRxiv - Immunology 2020
Quote:
Anti-SARS-CoV-2 IgG titers were determined using Human Anti-SARS-CoV-2 Virus Spike 1 (S1) IgG assay (Alpha Diagnostic). hIVIG batches were tested using multiple serial dilutions and a curve constructed by plotting the log of the optical density as a function of the log of the dilution ...
-
No products found
because this supplier's products are not listed.
Rachel E. Young, et al.,
bioRxiv - Bioengineering 2022
Quote:
... The apparent pKa of LNPs was determined via TNS [6-(p-toluidinyl)naphthalene-2-sulfonic acid] (Thomas Scientific, Swedesboro, NJ) assays ...
-
No products found
because this supplier's products are not listed.
Guoqiang Xu, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... and 2 μl diluted cDNA in Optical 8-Tube Strip using the Applied Biosystems 7300 Real-Time PCR Instrument (ABI, USA). The conditions for real-time PCR were as follows ...
-
No products found
because this supplier's products are not listed.
Rilee Zeinert, et al.,
bioRxiv - Biophysics 2024
Quote:
... and quickly washed with 3 µL of Nano-W Negative Stain (2% methylamine tungstate, Nanoprobes, Yaphank, NY, USA) followed by immediate incubation with 3 µL of Nano-W for 1 additional min ...
-
No products found
because this supplier's products are not listed.
Lea Antje Adolf, et al.,
bioRxiv - Microbiology 2023
Quote:
... Strains were grown in BHI with 10 μM of the iron chelator ethylenediamine-N,N’-bis(2-hydroxyphenylacetic acid) (EDDHA) (LGC Standards) to induce expression of iron-regulated genes for 3 days at 37°C with agitation ...
-
No products found
because this supplier's products are not listed.
Per Niklas Hedde, et al.,
bioRxiv - Microbiology 2020
Quote:
... The microarray slides used consisted of 2 × 8 pads of 7 mm × 7 mm each (Oncyte Avid, Grace Bio-Labs, Bend, OR). In this configuration ...
-
No products found
because this supplier's products are not listed.
Kailash Ramlaul, et al.,
bioRxiv - Biophysics 2023
Quote:
... and N3-PEG5k-NHS ester (Nanocs) stock was prepared at a final concentration of 40 mM in DMSO ...
-
No products found
because this supplier's products are not listed.
Tiago Carvalheiro, et al.,
bioRxiv - Immunology 2023
Quote:
... Soluble (s)LAIR-1 (as described previously34) and LAIR-2 (LifeSpan BioSciences) were also measured by ELISA in the serum of HC and SSc patients.
-
No products found
because this supplier's products are not listed.
Katelyn A. Bustin, et al.,
bioRxiv - Neuroscience 2023
Quote:
... (Bullet Blender, BBY24M model, Next Advance, Inc., speed 8, 3 min, 4 °C), samples were diluted in PBS (500 μL ...
-
No products found
because this supplier's products are not listed.
Yumaine Chong, Ellis Cooper,
bioRxiv - Neuroscience 2022
Quote:
... and rabbit anti-vesicular monoamine transporter 2 (1:1000; Phoenix Pharmaceuticals, Burlingame, CA)] ...
-
No products found
because this supplier's products are not listed.
Daisy Precilla S, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Caspase-3 (Cat. No: E-EL-R0160) and BCL-2 (Cat. No: E-EL-H0114) ELISA kits were purchased from Elabscience Biotechnology Inc ...
-
No products found
because this supplier's products are not listed.
Abby Trouth, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 2 µL i5 universal primer (EpiCypher), 2 µL i7 barcoded primer (EpiCypher) ...
-
No products found
because this supplier's products are not listed.
Anna C. Deleray, et al.,
bioRxiv - Bioengineering 2023
Quote:
... 2-hydroxyethyl starch (Spectrum Chemical, H3012) was used.
-
GelMA A is a blend of GelMA and alginate, offering a larger printability window compared to pure...
Cat# IK3521020303,
3 mL, USD $310.0
Ask
Samuel S. Hinman, et al.,
bioRxiv - Bioengineering 2021
Quote:
... were coated with 2 mL of 10 µg mL-1 human type 1 collagen (5007, Advanced Biomatrix) in 1× PBS (46-013-CM ...
-
No products found
because this supplier's products are not listed.
Alexandre Prola, et al.,
bioRxiv - Physiology 2024
Quote:
... anterior hindlimb compartments of 2/3-months-old C57BL6/J mice were injected with adeno-associated virus serotype 9 (AAV9 – Vector Biolabs) carrying either transgenes for STIM1 (AAV9-CMV-mStim1-2A-eGFP ...
-
No products found
because this supplier's products are not listed.
Nicholas O. Burton, et al.,
bioRxiv - Genetics 2021
Quote:
... mek-2 and gpdh-2 was synthesized and cloned into the L4440 vector by GENEWIZ (Takeley, UK). Vectors were transformed in E ...
-
No products found
because this supplier's products are not listed.
John Stegmayr, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... A 7000SMZ-2 Vibrotome (Campden Instruments Ltd.) equipped with a temperature controlled tissue bath (Campden Instruments Ltd. ...
-
No products found
because this supplier's products are not listed.
Etienne Becht, et al.,
bioRxiv - Immunology 2020
Quote:
... and 2% Armenian hamster serum (Innovative Research) followed by 15min incubation at 4°C ...
-
No products found
because this supplier's products are not listed.
Xiao He, Yunlu Kang, Lei Chen,
bioRxiv - Biochemistry 2022
Quote:
... 2 mM EGTA and 1 mM PMSF) with a disperser (IKA T18 digital ULTRA-TURRAX). The crude lysis was ultracentrifugated at 35 ...
-
No products found
because this supplier's products are not listed.
Stanimir S. Ivanov, et al.,
bioRxiv - Microbiology 2021
Quote:
... (2) incubated with rabbit anti-N.g antibody (Fitzgerald Ind.) in the presence (ΔdotA infections ...
-
No products found
because this supplier's products are not listed.
Karen Acuña Pilarte, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... and 2% Cholesterol (D09100301, Research diets Inc, New Brunswick NJ) with drinking water also supplemented with 23.1 g/L of D-fructose and 18.9g/L D-glucose (Sigma-Aldrich ...