-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 7: 3-methyl-L-histidine (NmH2, Chem-Impex International); 8 ...
-
6 micro-well glass bottom plate with #1 cover glass(0.13-0.16mm), micro-well size 14mm, with...
Cat# P06-14-1-N,
20/case, $178.00
Ask
Taemoon Chung, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 3×105 MIA PaCa-2/GemLuc cells were either plated day -1 on a black-walled 6 well plate (Cellvis, Mountain View, CA) or a clear bottom 6 well plate (Corning ...
-
No products found
because this supplier's products are not listed.
D.A.D. Flormann, et al.,
bioRxiv - Biophysics 2021
Quote:
... the samples were sputtered with 6-7 nm platinum (Coater: Model 681; Gatan, USA).
-
No products found
because this supplier's products are not listed.
Yohan S.S. Auguste, et al.,
bioRxiv - Neuroscience 2022
Quote:
... subcutaneous] before being anesthetized using isoflurane (SomnoSuite, Kent Scientific; 3-5% induction, 1-2% maintenance). Once anesthetic depth was achieved ...
-
No products found
because this supplier's products are not listed.
Carlos A. Rodríguez-Salazar, et al.,
bioRxiv - Immunology 2023
Quote:
... or 2,5-Dimethyl-4-sulfamoyl furan-3-carboxylic acid (SFC) (Enamine US inc.) pCEBS and SFC were diluted to final concentrations of 200 ...
-
No products found
because this supplier's products are not listed.
Rebendenne Antoine, et al.,
bioRxiv - Microbiology 2020
Quote:
... Caco-2 and Calu-3 cells were obtained from American Type Culture Collection (ATCC); HEK-Blue™ IFN-α/β and IFN-γ cells were obtained from InvivoGen ...
-
No products found
because this supplier's products are not listed.
Matthew S.J. Mangan, et al.,
bioRxiv - Immunology 2021
Quote:
... Rac1/2/3 (1:1000, rabbit polyclonal #2465) from CST, actin (mouse or rabbit, both 1:1,000 dilution) from LI-COR Biosciences ...
-
No products found
because this supplier's products are not listed.
Samantha L. Wilson, et al.,
bioRxiv - Genomics 2021
Quote:
... Labs 1 and 3 used Antibody 1 (Diagenode, Denville ...
-
No products found
because this supplier's products are not listed.
Su Yeon Kim, et al.,
bioRxiv - Neuroscience 2022
Quote:
Brains were washed 3 times for 15 minutes in 1× PBS and embedded in 3% low melt agarose (RPI, A20070) in 1× PBS ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 8: (S)-2-Amino-6-((2-(3-methyl-3H-diazirin-3-yl)ethoxy)carbonylamino)hexanoic acid (PhK, Iris Biotech GmBH); and 9 ...
-
No products found
because this supplier's products are not listed.
Subhrangshu Guhathakurta, et al.,
bioRxiv - Neuroscience 2020
Quote:
... from days 1-6 and 3-μM CHIR99021(Reprocell, 04-0004) from days 3-12 ...
-
No products found
because this supplier's products are not listed.
Steven R. Talbot, et al.,
bioRxiv - Animal Behavior and Cognition 2020
Quote:
... the cecum was 2/3 ligated (Nylon Monofilament Suture 6/0, Fine Science Tools GmbH, Heidelberg, Germany) distal to the ileocecal valve ...
-
No products found
because this supplier's products are not listed.
Mingrong Zuo, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... total-JNK1/2/3 (Abclonal #A4867), CCL2/MCP1 (Abclonal # A23288).
-
3',3'-Cyclic GAMP ( cGAMP ) ELISA / Assay Kit
Cat# K073-H1,
1.0 ea, USD $465.0
Ask
Abraham Shim, et al.,
bioRxiv - Genetics 2024
Quote:
... 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays #K067-H5) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Jaeseong Goh, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and B103 cells were incubated in 6 mL of medium containing 0.5% 3-(4,5-dimethylthiazol-2-yl)-2,5-di-phenyltetrazolium bromide (MTT; Amresco Inc., OH, USA) at 37 °C for 90 min and ASCs for 3 h ...
-
No products found
because this supplier's products are not listed.
Oghenerukevwe Akpoghiran, et al.,
bioRxiv - Neuroscience 2023
Quote:
... We employed 100 µL of 1-Bromo-3-Chloropropane (Molecular Research Center, Inc.) to separate the phases ...
-
No products found
because this supplier's products are not listed.
Caleb R. Carr, et al.,
bioRxiv - Microbiology 2024
Quote:
... 2 µL of 10 µM 3’ PacBio round 2 reverse primer (PacBio_3pri_RND2), and 25 µL KOD Hot Start Master Mix ...
-
No products found
because this supplier's products are not listed.
Per Niklas Hedde, et al.,
bioRxiv - Microbiology 2020
Quote:
... The microarray slides used consisted of 2 × 8 pads of 7 mm × 7 mm each (Oncyte Avid, Grace Bio-Labs, Bend, OR). In this configuration ...
-
No products found
because this supplier's products are not listed.
Laura Maria Florez, et al.,
bioRxiv - Immunology 2023
Quote:
... between passages 3 and 7 in complete mouse endothelial cell medium (from Cell Biologics, Euromedex) composed of mouse endothelial cell medium with the addition of endothelial cell medium supplement kit (from Cell Biologics ...
-
No products found
because this supplier's products are not listed.
Justin M. Westerfield, et al.,
bioRxiv - Biophysics 2021
Quote:
... the peptides were labeled at their N-terminus with an amine-reactive environmentally sensitive fluorescent reporter, Succinimidyl 6-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino)hexanoate (NBD-X, SE) (AnaSpec, Fremont, CA) [37] ...
-
No products found
because this supplier's products are not listed.
Dong Hun Lee, et al.,
bioRxiv - Physiology 2022
Quote:
Human pulmonary artery endothelial cells HPAEC (3 × 105/well) derived from 3 separate individuals were cultured in 6 well plates with ECM media (ScienCell, Carlsbad, CA) then treated with TGF-β (10 ng/ml) ...
-
No products found
because this supplier's products are not listed.
Juan Yang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Sulfo-Cyanine 3 Azide (2-5 uM final, Lumiprobe, #D1330), and fresh Sodium Ascorbate (100 mM final ...
-
No products found
because this supplier's products are not listed.
Zachary Beine, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The primary antibody (2-3% serum, 0.4% PBST, 1:500 Rockland 600-401-379) was applied and incubated for ninety minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Yue Qu, et al.,
bioRxiv - Neuroscience 2021
Quote:
The completed constructs in M-6-attB-UAS-1-3-4 vector were amplified in Epi300 competent cells (EpiCentre) in LB-Chloramphenicol medium ...
-
No products found
because this supplier's products are not listed.
Ida Paciello, et al.,
bioRxiv - Immunology 2024
Quote:
... 3 µg ml-1 of SARS-CoV-2 subunits diluted in carbonate-bicarbonate buffer (E107, Bethyl Laboratories), were coated in 384-well plates (microplate clear ...
-
No products found
because this supplier's products are not listed.
Tiesuo Zhao, et al.,
bioRxiv - Immunology 2024
Quote:
... cleaved-caspase 3 (1:1000, Bioworld), Pro-Caspase 3 (1:2000 ...
-
No products found
because this supplier's products are not listed.
Ding Xiong, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 2 to 3×106 cells were seeded in one 35mm glass bottom culture dishes (MatTek) after transient transfection ...
-
No products found
because this supplier's products are not listed.
Trinovita Andraini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 3-(2,4-Dichloro-5-methoxyphenyl)-2-sulfanyl-4(3H)-quinazolinone (BML-CM127-0050, Enzo Life Sciences) was injected at 20mg/kg (in 10% DMSO ...
-
No products found
because this supplier's products are not listed.
Danielle M Paul, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Kinesore (3,5-dibromo-N′-[2,5-dimethyl-1-(3-nitrophenyl)-1H-pyrrol-3-yl]methylene}-4-hydroxybenzohydrazide) was obtained from Chembridge Corporation (Cat ...
-
No products found
because this supplier's products are not listed.
Li Zhenyu, Li Tian, Liu Meisui, Ivanovic Tijana,
bioRxiv - Microbiology 2022
Quote:
... sn-(1-oleoyl-2-hydroxy)-glycerol-3-phospho-sn-3′-(1′-oleoyl-2’-hydroxy)-glycerol (ammonium salt) (18:1 BMP (R,R); Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Lauren Wegman-Points, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Corticosterone hemisuccinate (4-pregen-11B 21-DIOL-3 20-DIONE 21 hemisuccinate) (Steraloids, Newport RI) was added to tap water at concentration of 64.4mg/L (producing a final concentration of 50ug/ml CORT) ...
-
No products found
because this supplier's products are not listed.
Nina Sillner, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Cholic acid 7-sulfate (CA-S) and 3’-sialyllactose were purchased from Cayman (Biomol GmbH, Hamburg, Germany). Sulfate (S ...
-
LC Laboratories' Product Number D-2946 - Daidzein (4',7-Dihydroxyisoflavone,...
Cat# D-2946, SKU# D-2946_25g,
25 g, $450.00
Ask
Marisol Romero-Tejeda, et al.,
bioRxiv - Cell Biology 2023
Quote:
... supplemented with 6 µM of glycogen synthase kinase 3-inhibitor CHIR99021 (LC Labs, C-6556). On day 1 ...
-
No products found
because this supplier's products are not listed.
Yoshiteru Shimoda, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and emission fluorescence was collected via 3 photomultipliers and filters (PMT 1: 450-500 nm; PMT 2: 515-560 nm; PMT 3: 590-650 nm). iGluSnFR and iGABASnFR imaging was performed by using a spiral line scan at 40-60Hz at 320 × 320 pixel (512 × 512 μm ...
-
No products found
because this supplier's products are not listed.
Mohit Rajabhoj, et al.,
bioRxiv - Plant Biology 2023
Quote:
... from 2 to 3-day-old WT and mea-1-/-;dme-2-/- seedlings using NucleoSpin® Plant II (MACHEREY-NAGEL). 200 ng of DNA was subjected to fragmentation using ultrasonicator (Covaris ...
-
No products found
because this supplier's products are not listed.
Stephanie L. Schell, et al.,
bioRxiv - Immunology 2021
Quote:
7-9 week old mice were immunized with 4-hydroxy-3-nitrophenol–Keyhole Limpet Hemocyanin (NP-KLH) (Biosearch Technologies). NP-KLH was premixed in a 1:1 mixture of PBS ...
-
No products found
because this supplier's products are not listed.
Natalya Leneva, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... with 3 mol% of dipalmitoyl-phosphatidylinositol-3-phosphate (PI(3)P) (Echelon Biosciences) were prepared at a lipid concentration of 0.5 mg/ml in Buffer A by extrusion through a 0.4 μm polycarbonate filter (Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Anne-Charlotte Bon-Mathier, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Neonatal C57BL/6 mice (3 days after birth) were injected ip with NaCl or BNP every two days (1µg/2g; Bachem; synthetic mouse BNP (1-45) peptide (catalog number H-7558)) ...
-
No products found
because this supplier's products are not listed.
Gaëlle Hogrel, et al.,
bioRxiv - Biochemistry 2022
Quote:
... These were diluted 2-fold with water and ultracentrifuged using 3 kDa MWCO spin filters (Pall). Liquid chromatography analysis was performed on the Dionex UltiMate 3000 system ...
-
No products found
because this supplier's products are not listed.
Ranjan Sengupta, et al.,
bioRxiv - Cell Biology 2019
Quote:
Cell pellets (2-3 μl) were loaded onto copper membrane carriers (1mm x 0.5 mm; Ted Pella Inc.) and cryofixed using the EM PACT2 high pressure freezer (Leica) ...
-
No products found
because this supplier's products are not listed.
Juwel Chandra Baray, et al.,
bioRxiv - Immunology 2020
Quote:
... The plate was washed for 3 times then incubated with mouse sera and SARS-CoV-2 Spike antibody (Sino Biological, China) for 2 hours at 37 °C ...
-
No products found
because this supplier's products are not listed.
Tyler C. Detomasi, et al.,
bioRxiv - Genetics 2022
Quote:
... 3 mM of chitooligosaccharides (DP 3-6) (Megazyme, Wicklow, Ireland) were treated with 0.12 mg/mL of ChitO (Gecco Biotech ...
-
No products found
because this supplier's products are not listed.
Siyuan Zhao, et al.,
bioRxiv - Neuroscience 2021
Quote:
... (3) Spin-coating SU-8 precursor (SU-8 2000.5, MicroChem) at 3000 rpm ...
-
No products found
because this supplier's products are not listed.
Miguel Alejandro Lopez-Ramirez, et al.,
bioRxiv - Biochemistry 2019
Quote:
... 6-8 μM (Spherotech) were washed twice with wash buffer (20 mM Tris ...
-
No products found
because this supplier's products are not listed.
Reinaldo Sousa Dos Santos, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... cells were incubated with 100 μl Caspase-Glo® 3/7 reagent at room temperature for 1 h before recording luminescence with a POLASTAR plate reader (BMG Labtech, Germany).
-
No products found
because this supplier's products are not listed.
Kushal Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
No products found
because this supplier's products are not listed.
Emily G. Kuiper, et al.,
bioRxiv - Biochemistry 2019
Quote:
... was monitored during unfolding over a linear temperature gradient (35-95 °C) over 3 minutes on a Tycho NT.6 instrument (NanoTemper). The temperature at which a transition occurs in a plot of the first derivative of the fluorescence ratio (350/330 nm) ...
-
No products found
because this supplier's products are not listed.
Pazhanichamy Kalailingam, et al.,
bioRxiv - Pathology 2024
Quote:
... then incubated overnight at 37°C with staining buffer (5-bromo-4-chloro-3-indolyl β-D-galactopyranoside [X-gal, Bioline, London ...
-
No products found
because this supplier's products are not listed.
Mahmoud S Alghamri, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 3′-diaminobenzidine (DAB) (Biocare Medical) with nickel sulfate precipitation ...
-
No products found
because this supplier's products are not listed.
Silvana Valtcheva, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Nanoject III (Drummond Scientific, Item# 3-000-207) was used for AuCx ...