-
No products found
because this supplier's products are not listed.
Andrey Zakharchenko, et al.,
bioRxiv - Biochemistry 2022
Quote:
Glutaraldehyde-fixed BP samples (n=5) were punched using 8 mm biopsy punches (Medline, Northfield, IL). Samples were rinsed with PBS and then incubated for 28 days in PBS with the following conditions either without inhibitors (Control ...
-
No products found
because this supplier's products are not listed.
Zelin Liu, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... second-strand cDNAs were synthesized using P2-T24 (5’-ATATCTCGAGGGCGCGCCGGATCCTTTTTTTTTTTTTTTTTTTTTTTT-3’) by I-5 High-Fidelity DNA polymerase (MCLAB) at 98°C for 2 min ...
-
No products found
because this supplier's products are not listed.
Jan A. Veenstra,
bioRxiv - Zoology 2023
Quote:
... Peptides with an N- or C-terminal cysteine were conjugated through this residue using 4-(N-Maleimidomethyl)cyclohexane-1-carboxylic acid 3-sulfo-N-hydroxysuccinimide ester (AK Scientific, Inc., Union City, CA 94587, USA) to bovine serum albumin (BSA) ...
-
No products found
because this supplier's products are not listed.
Cathrin LC Gudd, et al.,
bioRxiv - Immunology 2023
Quote:
... 20 μg/mouse of TLR9-L (CpG oligodeoxynuleotide 1668: 5-S-TCCATGACGTTC CTGATGCT-3) (TIB Molbiol, Germany) was administered i.p ...
-
No products found
because this supplier's products are not listed.
Alejandro A. Pezzulo, et al.,
bioRxiv - Genomics 2021
Quote:
... quenching of endogenous peroxidase (3% hydrogen peroxide, 8 minutes) and blocking of nonspecific stain (Background Buster x 30 minutes, Innovex Biosciences, Richmond, CA, USA). A mouse monoclonal anti-p63 antibody (1:500 ...
-
No products found
because this supplier's products are not listed.
Vipul T. Vachharajani, et al.,
bioRxiv - Biophysics 2023
Quote:
... 3-5 mm wide slits were cut with a razor blade into a piece of Parafilm M (Bemis) and sandwiched between a glass slide (1 mm thick ...
-
No products found
because this supplier's products are not listed.
Jessica Hoff, et al.,
bioRxiv - Biochemistry 2021
Quote:
... and 5 U mL-1 DY-636 conjugated Phalloidin (Dyomics) for 60 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Justin R. Blanch, et al.,
bioRxiv - Genetics 2022
Quote:
... and sequenced with a primer located upstream of the I-SceI cut site (DR-white2, 5’ ATGCAGGCCAGGTGCGCCTATG 3’) (Eton Bioscience).
-
No products found
because this supplier's products are not listed.
Ian Hoskins, et al.,
bioRxiv - Genomics 2023
Quote:
gDNA was extracted from approximately 3-4 million cells with the Cell and Tissue DNA Isolation Kit (Norgen Biotek Corp, 24700), including RNaseA treatment at 37 °C for 15 min ...
-
No products found
because this supplier's products are not listed.
Rebekah Honce, et al.,
bioRxiv - Microbiology 2021
Quote:
... and oseltamivir carboxylate (Toronto Research Chemicals, Lot 3-SKC-52-1, Purity 98%) with a qualified LC MS/MS assay ...
-
No products found
because this supplier's products are not listed.
Gabriel Brawerman, et al.,
bioRxiv - Cell Biology 2021
Quote:
... aliquots of the low and high glucose supernatants and the insulin content extracts were collected and spun at 3000g for 5 minutes at 4°C and stored at −20°C or used immediately for mouse or human insulin ELISAs (Mercodia) with appropriate dilutions (1:10-1:50 for supernatants ...
-
No products found
because this supplier's products are not listed.
Shivanand Hegde, et al.,
bioRxiv - Microbiology 2019
Quote:
... 3 min 3% bleach+0.01% Coverage Plus NPD (Steris Corp.), 5 min in 70% ethanol then rinsed three times in sterile water ...
-
No products found
because this supplier's products are not listed.
J. Roman Arguello, et al.,
bioRxiv - Neuroscience 2020
Quote:
Antennae from ∼2000 flies (∼1-8 days old) of the desired genotype were harvested by snap-freezing flies in a mini-sieve (Scienceware, Bel-Art Products) with liquid nitrogen ...
-
No products found
because this supplier's products are not listed.
Md Imtiaz Khalil, Arrigo De Benedetti,
bioRxiv - Cancer Biology 2022
Quote:
LNCaP and PC3 cells were treated with 1-5 μM of GLPG 0259 (Medkoo Biosciences, Inc. ...
-
No products found
because this supplier's products are not listed.
Glennis A. Logsdon, et al.,
bioRxiv - Genomics 2020
Quote:
... and then incubated with a mouse monoclonal anti-CENP-A antibody (1:200, Enzo, ADI-KAM-CC006-E) and rabbit monoclonal anti-5-methylcytosine antibody (1:200, RevMAb, RM231) for 3 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Huabo Wang, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... All animals were maintained on 8 mg/L NTBC (Ark Pharm, Libertyville, IL) in their drinking water ...
-
No products found
because this supplier's products are not listed.
Hailey Larose, et al.,
bioRxiv - Plant Biology 2022
Quote:
... 5-deoxystrigol (5DS; StrigoLab) or Oro ...
-
No products found
because this supplier's products are not listed.
Roman Franěk, et al.,
bioRxiv - Zoology 2019
Quote:
... and 3 μl PCR H2O (Top-Bio). Reaction conditions were 30 cycles of 94 °C for 30 s ...
-
No products found
because this supplier's products are not listed.
Lei Li, et al.,
bioRxiv - Immunology 2021
Quote:
... with 1 or 5 μg rSp alone or mixed with either 1 mg Advax-SM adjuvant or where indicated 50 μg Al(OH)3 (2% Alhydrogel, Croda Denmark) in the thigh muscle at weeks 0 and 2 ...
-
No products found
because this supplier's products are not listed.
Jijin R. A. Kuttiyatveetil, et al.,
bioRxiv - Biochemistry 2021
Quote:
... ICP-MS standards QCP-QCS-3 (Inorganic Ventures) and QCS-27 (High Purity Standards ...
-
No products found
because this supplier's products are not listed.
Stephen Meek, et al.,
bioRxiv - Immunology 2021
Quote:
... 25 ng/ml rpIL-3 (Kingfisher Biotech, #RP1298S). Attached EBs were fed every 4 days with Macrophage Induction medium ...
-
No products found
because this supplier's products are not listed.
Hyeree Park, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Aliquots of 1 mL of each solution was cast in a 4 mL Wheaton Omni-Vial® (DWK Life Sciences, USA). Human ACL fibroblast-osteoblast seeded ADCs were cultured for 14 days tethered ...
-
No products found
because this supplier's products are not listed.
Li-Ying Yu, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The cells were grown for 5 days in iCell Neural Base Medium 1+ iCell Neural Supplement B (M1010, M1029, FUJIFILM Cellular Dynamics). Then the cells were treated with 6-OHDA (50 µM ...
-
No products found
because this supplier's products are not listed.
Saya Furukawa, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Working stocks of 30 mM SU5402 (#193-16733, Wako) and 8 mM Cyclopamine (#C9710, LKT Labs, Inc.) were made in DMSO (#08904-14 ...
-
No products found
because this supplier's products are not listed.
Jason Yun, et al.,
bioRxiv - Bioengineering 2023
Quote:
... indole-3-acetic acid from Neta Scientific (Hainesport, NJ, USA), asunaprevir was purchased from AdooQ Biosciences (Irvine ...
-
No products found
because this supplier's products are not listed.
Jingyou Yu, et al.,
bioRxiv - Microbiology 2021
Quote:
... The plates were washed with ELISPOT wash buffer (11% 10x DPBS and 0.3% Tween20 in 1L MilliQ water) and incubated for 2 h with Rabbit polyclonal anti-human IFN-γ Biotin from U-Cytech (1 µg/mL). The plates were washed a second time and incubated for 2 h with Streptavidin-alkaline phosphatase from Southern Biotech (2 µg/mL) ...
-
No products found
because this supplier's products are not listed.
Qinghong Xue, et al.,
bioRxiv - Immunology 2019
Quote:
... and goat IgG (i.e., three positive control points) were printed in 4×4 array by non-contact spotter sciFLEXARRAYER S1 (Scienion, Berlin, Germany) (Fig 2d) ...
-
No products found
because this supplier's products are not listed.
A. Florentin, et al.,
bioRxiv - Microbiology 2019
Quote:
... beads using 5 mM BS3 crosslinker (CovaChem) and then incubated with the supernatant at 4°C ...
-
No products found
because this supplier's products are not listed.
Benjamin T. Throesch, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... 5 mM MgCl2-6H2O (Honeywell Research Chemicals), 1 mM CaCl2 (Honeywell Research Chemicals) ...
-
No products found
because this supplier's products are not listed.
Emily L. Pruitt, et al.,
bioRxiv - Microbiology 2023
Quote:
... and C20:4 (Nu-Chek Prep, Inc., Elysian, MN) in ethanol each at 100 μM in TSB ...
-
No products found
because this supplier's products are not listed.
Sara C. Di Rienzi, et al.,
bioRxiv - Microbiology 2022
Quote:
... 3-inch needle (N163D, Air-Tite Vet Premium Hypodermic Needles, USA) positioned at the level within the glass reactor such that the media level was at 15 mls ...
-
No products found
because this supplier's products are not listed.
Tongjie Wang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... adult C57BL/6 (CD45.1, 8-10 weeks old) recipient mice were irradiated with 2 doses of 4.5Gy (RS 2000, Rad Source) for a 4-hour interval ...
-
No products found
because this supplier's products are not listed.
Fátima Sanchís-Calleja, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... using paired-end 28/10/10/90 or 28/8/0/91 configuration (Read1/IDX i7/IDX i5/Read2). After sample demultiplexing ...
-
No products found
because this supplier's products are not listed.
Morten Dencker Schostag, et al.,
bioRxiv - Microbiology 2019
Quote:
... Gas samples were transferred to 3-mL Exetainer vials (LABCO, Lampeter, UK) and analyzed using an autosampler (Mikrolab Aarhus ...
-
No products found
because this supplier's products are not listed.
Aliya Sharipova, et al.,
bioRxiv - Bioengineering 2022
Quote:
... the Fe with 1wt% VH precursor mixture was loaded into a custom-build consolidation die and high-pressure cold-sintered at 2.5 GPa (corresponding to 5 t for 5 mm diameter die) and RT using manual press (Carver, Wabash, IN, USA) to obtain the drug-loaded metal (Supplementary Materials ...
-
No products found
because this supplier's products are not listed.
Steven A. Erickson, et al.,
bioRxiv - Immunology 2021
Quote:
... 5-7 IU of PMSG (Millipore #367222/BioVendor #RP1782721000) was injected (IP ...
-
No products found
because this supplier's products are not listed.
Robert G. Stewart, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 5 mm German glass coverslips (Bellco Glass, 1943-00005), which had previously been washed in 70% ethanol and sterilized with ultraviolet light ...
-
No products found
because this supplier's products are not listed.
Aritra Nath Kundu, et al.,
bioRxiv - Bioengineering 2023
Quote:
... for 3 hours at room temperature in a peptide synthesis vessel (ChemGlass, Vineland, NJ). The peptide solution was filtered to remove the resin and the peptide was precipitated out using diethyl ether at -80°C ...
-
No products found
because this supplier's products are not listed.
Marie Ouarné, et al.,
bioRxiv - Cell Biology 2023
Quote:
... a stock of 50mg 5-ethynyl-2-deoxyuridine (EdU) (Alfagene, A10044) was diluted in 5mL of PBS to make a working solution (10mg/mL) ...
-
No products found
because this supplier's products are not listed.
Abrar Choudhury, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... whole skulls were subsequently embedded in 5% low-melt agarose (Precisionary) and cut into 300µm sections on a Vibratome (VT1000S ...
-
No products found
because this supplier's products are not listed.
Rebekka Medert, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Pools of 2 or 3 E4.5 blastocysts were lysed in 10 μl lysis buffer (DirectPCR buffer, Viagen, supplemented with 2.5 μg/ml Proteinase K ...
-
No products found
because this supplier's products are not listed.
Martina Ruglioni, et al.,
bioRxiv - Biophysics 2023
Quote:
Cells were seeded (3×105) in 35 mm glass-bottom dishes (WillCo Wells BV, Amsterdam, The Netherlands) with 2 ml of culture medium and maintained at 37°C and 5% CO2 for 24 prior to transfection (vide infra ...
-
No products found
because this supplier's products are not listed.
Jun Li, et al.,
bioRxiv - Bioengineering 2023
Quote:
YS5 was first conjugated with the bi-functional chelator 2-(4-isothiocyanotobenzyl)-1,4,7,10-tetraaza-1,4,7,10-tetra-(2-carbamoylmethyl)-cyclododecane (TCMC; Macrocyclics, Plano, TX) at the molar ratio of TCMC/YS5 at 10:1 ...
-
No products found
because this supplier's products are not listed.
Maik Müller, et al.,
bioRxiv - Systems Biology 2020
Quote:
... Peptides were C18-purified using 5–60 μg UltraMicroSpin Columns (The Nest Group, cat: SEMSS18V) according to manufacturer’s instructions and subjected for mass spectromic analysis using an Orbitrap Fusion Tribrid mass spectrometer (Thermo Scientific ...
-
No products found
because this supplier's products are not listed.
Divine C. Nwafor, et al.,
bioRxiv - Neuroscience 2021
Quote:
... D3 cells were seeded onto 3 independent collagen-coated 16-well E-Plate PET arrays (ACEA Biosciences, San Diego, CA) at a concentration of 20,000 cells/well and loaded onto an xCelligence RTCA DP system (ACEA Biosciences ...
-
No products found
because this supplier's products are not listed.
Shene Chiou, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Tissues were homogenised with 10 pcs of 3 mm Acid-Washed Zirconium Beads (OPS diagnostics Cat# BAWZ 3000-300-23) in a Qiagen TissueLyzer II (30 Hz ...
-
No products found
because this supplier's products are not listed.
Sophie E. Cousineau, et al.,
bioRxiv - Microbiology 2022
Quote:
... mouse anti-JFH-1 NS5A (clone 7B5, BioFront Technologies, 1:10,000). Blots were incubated for 1 hour with HRP-conjugated secondary antibodies diluted in 5% skim milk ...
-
No products found
because this supplier's products are not listed.
Maxwell P. Bui-Marinos, et al.,
bioRxiv - Immunology 2021
Quote:
... and RNA quality was examined by electrophoresing 1 μg of RNA on a 1% agarose gel containing 1% bleach (Aranda et al., 2012) and 1 × RedSafe nucleic acid staining solution (FroggaBio) in 1 × TAE buffer at 100 V for 35 min ...
-
No products found
because this supplier's products are not listed.
Rita F. Santos, et al.,
bioRxiv - Immunology 2022
Quote:
... for 1 h with 1 μg/ml of the sAg staphylococcal enterotoxin E (SEE) (Toxin Technologies). After 24 h of culture at 37 °C ...
-
No products found
because this supplier's products are not listed.
Linglei Jiang, et al.,
bioRxiv - Immunology 2022
Quote:
... IgA (1:250, Brookwood Biomedical, AL, USA) or IgM (1:250 ...