-
No products found
because this supplier's products are not listed.
Priyanka Nain, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... 3-(4-hydroxy-3-methoxyphenyl) propanal was procured from AA Blocks. 3-(4-Hydroxy-3-methoxyphenyl ...
-
No products found
because this supplier's products are not listed.
A Prabhakar, et al.,
bioRxiv - Immunology 2021
Quote:
... 2-3 ml blood was collected in RNAgard blood tubes (Biomatrica, USA) and stored in −80°C until RNA precipitation ...
-
No products found
because this supplier's products are not listed.
Aditya R. Yelamali, et al.,
bioRxiv - Immunology 2024
Quote:
... streptavidin-azide (SAv-azide; 2-4 azide groups per tetramer, Protein Mods) at 2-5 mg/mL stock concentration in PBS was prepared for payload conjugation by first adding DMSO to 20% final concentration as cosolvent.
-
No products found
because this supplier's products are not listed.
Eileen M. Lynch, et al.,
bioRxiv - Pathology 2024
Quote:
... Amplified samples were run on a 2% agarose gel (Lamda Biotech, Inc., A113-3) containing 0.5μg/mL ethidium bromide (Millipore Sigma ...
-
No products found
because this supplier's products are not listed.
Soner Sonmezoglu, et al.,
bioRxiv - Bioengineering 2021
Quote:
... tris-(Bathophenanthroline) Ruthenium (II) Perchlorate (Ru(dpp)3(ClO4)2) (CAS 75213-31-9; GFS Chemicals), were immobilized on the surface of silica particles with a diameter of 10 µm (CAS 7631-86-9 ...
-
The enzyme from Escherichia coli requires Mg2+ or Mn2+. ATP or UTP can replace CTP, but both are...
Cat# EXWM-3272,
100 ug, contact supplier for pricing
Ask
Hui Tian, et al.,
bioRxiv - Plant Biology 2020
Quote:
... and after 2 h of incubation 3 μL of chitinase from Clostridium thermocellum (Creative Enzymes, New York, USA) was added into the appropriate wells ...
-
No products found
because this supplier's products are not listed.
Arthur J. Jallet, Arnaud Le Rouzic, Anne Genissel,
bioRxiv - Evolutionary Biology 2019
Quote:
... 50 mL of frozen cell suspension were lyophilized for 3 days (LYOVACTM GT 2-E freeze dryer, Steris) and ground in liquid nitrogen to a fine powder with a mortar and pestle ...
-
No products found
because this supplier's products are not listed.
Cassandra M. Stawicki, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Aliquots of 2-5 µl of sample were added to 700 µl of 2% PBS and loaded into a cuvette (BrandTech Scientific, 759150). Zeta potential was measured in Folded Capillary Cell cuvettes (Malvern ...
-
No products found
because this supplier's products are not listed.
Alberto Perez-Alvarez, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and 4 μM cytosine β-D-arabinofuranoside added 48 hours after plating in 6 mm diameter cloning cylinders (Ace Glass).
-
No products found
because this supplier's products are not listed.
Yuichi Shichino, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and then incubated with 150 μl of FLAG elution buffer (FLAG wash buffer 2 with 1 mg/ml 3×FLAG peptide [Protein Ark, GEN-3XFLAG-25]) overnight ...
-
No products found
because this supplier's products are not listed.
Andrea M. Chambers, et al.,
bioRxiv - Immunology 2021
Quote:
... 500 IU/mL IL-2 (Akron Biotech), 50 ng/mL hIL-21 (Gold Bio) ...
-
No products found
because this supplier's products are not listed.
Aswini Panigrahi, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Anti-Sulf-2 monoclonal antibodies (QED Bioscience), Anti-LG3BP monoclonal antibody (Proteintech) ...
-
No products found
because this supplier's products are not listed.
Fei Mao, et al.,
bioRxiv - Neuroscience 2021
Quote:
... anti-GAPDH antibody (catalog # 2-RGM2, Advanced ImmunoChemical) was used at 1 μg/mL.
-
No products found
because this supplier's products are not listed.
Matthew D. Kerr, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 1-bicyclo[2.2.1]hept-5-en-2-ylmethanamine (norbornene amine) was purchased from Matrix Scientific (# 038023, lot: M15S). Cy5-tetrazine amine was purchased from Lumiprobe (lot ...
-
No products found
because this supplier's products are not listed.
Federica De Marco, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Sugar quantification was assayed enzymatically (Enzytec™ Sucrose/D-Glucose/D-Fructose-R-Biopharm AG kit) (Vilaine et al. ...
-
No products found
because this supplier's products are not listed.
Jens O. Watzlawik, et al.,
bioRxiv - Neuroscience 2024
Quote:
... free p-S65-Ub peptides 1 and 2 and BSA-conjugated p-S65-Ub peptides 1 and 2 (provided by 21st Century Biochemicals). Non-phosphorylated Ub protein (Boston Biochem ...
-
No products found
because this supplier's products are not listed.
Jingling Zhao, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and GHb was evaluated every 2 months (Helena Laboratories).
-
No products found
because this supplier's products are not listed.
Limin Shang, et al.,
bioRxiv - Genomics 2020
Quote:
... The PCR reactions were performed with I-5™ 2×High-Fidelity Master Mix (MCLAB, TSINGKE Biological Technology, China) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Thomas W. Jackson, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... and 2H,2H,3H,3H-Perfluorooctane-1-sulfonate (6:2 FTSA, CAS 59587-39-2, purity ≥ 97%) were from Synquest Laboratories (Alachua, FL). HSA (CAS 70024-90-7 ...
-
No products found
because this supplier's products are not listed.
Cassandre B. Pyne, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
... we used a PippinPrep (D-Mark Biosciences) to size select DNA fragments with lengths between 250 and 350 base pairs ...
-
No products found
because this supplier's products are not listed.
Andrew Chase, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Rabbit anti-FLAG (Signalway Antibody LLC, Maryland, USA; T503-2), tubulin (Abcam ...
-
No products found
because this supplier's products are not listed.
Aurelie Velay, et al.,
bioRxiv - Microbiology 2020
Quote:
... ELISA anti-SARS-CoV-2 IgA and IgG (Euroimmun, Lübeck, Germany) and (2) ELISA-2: EDI™ novel coronavirus COVID-19 IgM and IgG (Epitope Diagnostics, San Diego, CA, USA). Technical characteristics of the assays are summarized in the Supplementary data (Table S1) ...
-
No products found
because this supplier's products are not listed.
Koki Ueda, et al.,
bioRxiv - Developmental Biology 2023
Quote:
Serum vitamin D (25(OH)D) levels of mouse serum samples were assessed by commercially available ELISA kits (Eagle Biosciences, Inc ...
-
No products found
because this supplier's products are not listed.
Mirjana Grujic, et al.,
bioRxiv - Immunology 2022
Quote:
... and 3 µl Draq7 (Biostatus, Shepshed Leicestershire ...
-
No products found
because this supplier's products are not listed.
Vincenzo Davide Aloi, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and treated overnight at 4°C with the primary antibody (rabbit anti-pERK; 1:200, PhosphoSolutions). The pre-treated sections were then incubated for 2 hours at room temperature with goat anti-rabbit conjugated to Cy3 ...
-
No products found
because this supplier's products are not listed.
Vipul T. Vachharajani, et al.,
bioRxiv - Biophysics 2023
Quote:
... 3-5 mm wide slits were cut with a razor blade into a piece of Parafilm M (Bemis) and sandwiched between a glass slide (1 mm thick ...
-
No products found
because this supplier's products are not listed.
Roman Franěk, et al.,
bioRxiv - Zoology 2019
Quote:
... and 3 μl PCR H2O (Top-Bio). Reaction conditions were 30 cycles of 94 °C for 30 s ...
-
No products found
because this supplier's products are not listed.
Xingyu Chen, et al.,
bioRxiv - Biophysics 2021
Quote:
... 2.5:0.1,2.5:0.5, 2.5:1, and 2.5:2, 1.5 MDa sodium hyaluronate from Lifecore Biomedical). The gel solutions were incubated at 37°C overnight and were then submerged in deionized water at room temperature ...
-
No products found
because this supplier's products are not listed.
Greg. A. Timblin, et al.,
bioRxiv - Immunology 2022
Quote:
... 4-phosphopantetheine (CX11340) was from Chiralix. MPLA (tlrl-mpls) ...
-
No products found
because this supplier's products are not listed.
Mikel Garcia-Marcos, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Fluorescein di-β-D-galactopyranoside (FDG) was from Marker Gene Technologies, and the protein inhibitor mixture was from Sigma (catalog no ...
-
No products found
because this supplier's products are not listed.
Elana M. Meijer, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 3 x 3 dotted patterns were created on the membranes of a 6-well Bioflex culture plate (untreated, Flexcell Int). Videos were captured at day 3 (the first day of straining ...
-
No products found
because this supplier's products are not listed.
Stephen Meek, et al.,
bioRxiv - Immunology 2021
Quote:
... 25 ng/ml rpIL-3 (Kingfisher Biotech, #RP1298S). Attached EBs were fed every 4 days with Macrophage Induction medium ...
-
No products found
because this supplier's products are not listed.
Justin R. Blanch, et al.,
bioRxiv - Genetics 2022
Quote:
... and sequenced with a primer located upstream of the I-SceI cut site (DR-white2, 5’ ATGCAGGCCAGGTGCGCCTATG 3’) (Eton Bioscience).
-
No products found
because this supplier's products are not listed.
Hong Zheng, et al.,
bioRxiv - Microbiology 2021
Quote:
... the cells were labeled with 1:500 rabbit anti-CSP overnight at 4°C and 1:100 Red donkey anti-rabbit secondary antibody (Abbkine) for 1 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Alyssa F. Pybus, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Samples were incubated at 4°C overnight with primary antibodies diluted in blocking buffer: GFAP (1:100, Diagnostic Biosystems Mob064), NeuN (1:200 ...
-
No products found
because this supplier's products are not listed.
Naomi-Liza Denning, et al.,
bioRxiv - Immunology 2019
Quote:
... Macrophages from healthy human donors were obtained from Hemacare (Cat. No. PBMACC-MON-2, Northridge, CA). Murine peritoneal macrophages were isolated from adult male mice38 ...
-
No products found
because this supplier's products are not listed.
Sasisekhar Bennuru, et al.,
bioRxiv - Microbiology 2021
Quote:
... collagens (B. malayi and C. elegans) were aligned in MegAlign Pro (DNASTAR, Lasergene 17) using MUSCLE algorithm ...
-
No products found
because this supplier's products are not listed.
Daisuke Shimura, et al.,
bioRxiv - Cell Biology 2021
Quote:
... using Mouse Mitochondrial DNA Copy Number Assay kit (Detroit R&D, Detroit, MI) for the samples from the mouse heart or Human Mitochondrial DNA Monitoring Primer Set (TaKaRa Bio ...
-
No products found
because this supplier's products are not listed.
Mathew Miller, et al.,
bioRxiv - Molecular Biology 2022
Quote:
MULTI-ARRAY Standard 96-well plates (Meso Scale Diagnostics, Rockville, Maryland) were coated overnight at 4°C with K1 anti-dsRNA mouse monoclonal antibody (SCICONS, Budapest, Hungary). Plates were blocked using 5% MSD Blocker A (Meso Scale ...
-
No products found
because this supplier's products are not listed.
Clara Alameda, et al.,
bioRxiv - Neuroscience 2023
Quote:
... participants were fitted with 3-ECG electrodes (Ambu, Ballerup, Denmark) and a 64-channel actiCHamp EEG system (Brain Products ...
-
No products found
because this supplier's products are not listed.
Qinghong Xue, et al.,
bioRxiv - Immunology 2019
Quote:
... and goat IgG (i.e., three positive control points) were printed in 4×4 array by non-contact spotter sciFLEXARRAYER S1 (Scienion, Berlin, Germany) (Fig 2d) ...
-
No products found
because this supplier's products are not listed.
Unekwu M. Yakubu, Kevin A. Morano,
bioRxiv - Biochemistry 2021
Quote:
α-synuclein thioflavin T binding assays were performed by incubating 2 μM α-synuclein monomer (StressMarq Biosciences, Victoria, BC, Canada), 1 μM pre-formed fibrils (StressMarq Biosciences ...
-
No products found
because this supplier's products are not listed.
Elisa M Nabel, et al.,
bioRxiv - Neuroscience 2020
Quote:
Mice were anesthetized with 2% isoflurane and head-fixed on in a mouse stereotactic apparatus (Narishige International USA Inc.) equipped with a heating pad ...
-
No products found
because this supplier's products are not listed.
Bryana N. Harris, et al.,
bioRxiv - Systems Biology 2022
Quote:
Cardiac myocytes were isolated from 1-2-day-old Sprague-Dawley rats using a Neomyt isolation kit (Cellutron, USA). The cells were cultured in plating media (low-glucose Dulbecco’s modified eagle media (DMEM) ...
-
No products found
because this supplier's products are not listed.
Xiaoqi Zhu, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and then centrifuged at 1000 ×g/min for 10 min at 4°C to obtain plasma for measuring fructosamine with fructosamine reagents (IDEXX Catalyst™ Test; Westbrook, ME, USA) on IDEXX VetTest equipment ...
-
No products found
because this supplier's products are not listed.
Kristina Astleford-Hopper, et al.,
bioRxiv - Cell Biology 2022
Quote:
3-month-old femora were isolated and fixed in Z-fix (Anatech LTD) and placed in 10% EDTA (pH 7.4 ...
-
No products found
because this supplier's products are not listed.
K. Saini, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... (3Helix, Inc., B-CHP) and fluorescent Streptavidin conjugate Alexa-594 (Thermofisher -S11227 ...
-
No products found
because this supplier's products are not listed.
Liz M. Florez, et al.,
bioRxiv - Plant Biology 2020
Quote:
... PCR amplification products were visualised following gel electrophoresis in a 2% (w/v) agarose gel in 1x Tris Acetate-EDTA (TAE) buffer with RedSafe™ (Intron Biotechnology, SEL, Korea), at the manufacturer’s recommended concentration ...
-
No products found
because this supplier's products are not listed.
Marine Zagdoun, et al.,
bioRxiv - Microbiology 2019
Quote:
... adapted as follows: 20 g of meat were homogenized for 2 × 30 s in a stomacher bag (BagPage, Interscience, Saint-Nom-la-Bretèche, France) with 40 mL of sterile ultrapure water supplemented with 1% Tween 80 (Acros Organics ...
-
No products found
because this supplier's products are not listed.
Daniela Niemeyer, et al.,
bioRxiv - Microbiology 2021
Quote:
... and B.1.351-HRP-RBD (provided by Medac, Wedel, Germany) solution and incubated at 37°C for 30 minutes ...