-
No products found
because this supplier's products are not listed.
J. Ignacio Gutiérrez, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 100 uM Gal4–VP16 (Protein One, P1019-02) and 100 uM ATP or AMP-PNP ...
-
No products found
because this supplier's products are not listed.
Hongbing Zhang, et al.,
bioRxiv - Bioengineering 2020
Quote:
The E-ALPHA® human scFv antibody phage display libraries (Eureka Therapeutics) were used for the selection of human antibody constructs specific to SARS-CoV-2 spike protein ...
-
No products found
because this supplier's products are not listed.
Kathleen M.E. Gallagher, et al.,
bioRxiv - Immunology 2021
Quote:
A qualitative ELISA for Human Anti-IgG/A/M SARS-CoV-2 ELISA (The Binding Site) was performed using donor serum per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Alyssa R. Phillips, et al.,
bioRxiv - Plant Biology 2023
Quote:
... About 1 mm of the tip (meristem and root cap) was excised and transferred to a tube containing 20 µL of 3% cellulase R-10 (Desert Biologicals, Phoenix, AZ) and 1.25% pectolyase Y-23 (Desert Biologicals ...
-
No products found
because this supplier's products are not listed.
Hui-Hsuan Kuo, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 10 μg ml−1 Oryza sativa-derived recombinant human transferrin (Optiferrin, InVitria, 777TRF029-10G,), 14 ng ml−1 sodium selenite (Sigma ...
-
No products found
because this supplier's products are not listed.
Shauni L. Geeraerts, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... washing step and Annexin V (IQ Products IQP-120R, 1:100 in binding buffer) staining for 15 min at RT in the dark ...
-
No products found
because this supplier's products are not listed.
Jiling Feng, Yuexun Tang, Wenwei Fu, Hongxi Xu,
bioRxiv - Cell Biology 2023
Quote:
... RT-PCR was performed with a one-step real time PCR using KAPA SYBR FAST One-Step qRT-PCR Universal (D-MARK Biosciences). Primers were used as previously described [18] ...
-
Peptide to PAR-3 (1-6) (Human)
Cat# CCP2734,
1 mg USD $100.0, 5 mg USD $250.0, 10 mg USD $375.0
Ask
Huy-Dung Hoang, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The following primary antibodies and corresponding dilution were used: 1:500 α-INPP5E (# CPA3073, Cohesion Biosciences), 1:10,000 α-β-actin (#A5441 ...
-
No products found
because this supplier's products are not listed.
Ruhi Patel, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... plated on solid NGM supplemented with 8 mM isopropyl β-D-1-thiogalactopyranoside (IPTG, Laguna Scientific), and incubated for 16 to 24 h at 25° C ...
-
No products found
because this supplier's products are not listed.
Gregory M Wright, et al.,
bioRxiv - Cell Biology 2023
Quote:
... FISH was performed using probes for the MT locus in 16q12.2 (56,396,107 to 56,782,063 on chromosome 16 in GRCh37) and chromosome 16 α-satellite purchased from Oxford Gene Technology, who performed paired-end sequencing to verify the identity of the BACs ...
-
No products found
because this supplier's products are not listed.
Neil J Rzechorzek, et al.,
bioRxiv - Biochemistry 2020
Quote:
... HEK293-F cells were grown in 400 mL batches in 2 L non-baffled Erlenmeyer flasks (TriForest Enterprises Inc, #FPC2000S) to a cell density of ∼1×106 cells/mL.
-
No products found
because this supplier's products are not listed.
Shengyun Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...
-
No products found
because this supplier's products are not listed.
Stanimir S. Ivanov, et al.,
bioRxiv - Microbiology 2021
Quote:
The human monocytic cell line U937 (ATCC CRL-1593.2) was obtained from ATCC and primary human peripheral monocytic cells (PBMCs) from two different donors were purchased from Precision for Medicine. U937 cells were cultured in RPMI 1640 media (VWR ...
-
No products found
because this supplier's products are not listed.
Neha E. H. Dinesh, et al.,
bioRxiv - Cell Biology 2023
Quote:
... For sanger sequencing PCR reactions were performed using specific oligos against the target FN domains (Supp Table 2) and Taq DNA Polymerase kit (ZmTech Scientifique; Catalogue #T207025) and analyzed on 2% agarose gels ...
-
No products found
because this supplier's products are not listed.
Sarah Howald, et al.,
bioRxiv - Physiology 2021
Quote:
... The magnetic stirrers were connected to one stirrer controller (Rank Brothers Ltd., Cambridge, England). The chamber was closed with a custom-made glass lid with three metal ports ...
-
No products found
because this supplier's products are not listed.
Marlene Corbet, et al.,
bioRxiv - Pathology 2020
Quote:
... male DBA/1 mice (8-weeks old) were injected intradermally on day 0 with 100 µg Bovine Type II collagen (CII; MD biosciences) in complete Freunds adjuvant (CFA ...
-
No products found
because this supplier's products are not listed.
Devika Prasanth, et al.,
bioRxiv - Biophysics 2019
Quote:
Simulated microgravity conditions were produced using a Rotary Cell Culture System (RCCS™) (Fig. 1) developed at the Johnson Space Center by NASA and made commercially available by Synthecon® Inc (Houston ...
-
No products found
because this supplier's products are not listed.
Pedro Gonzalez-Menendez, et al.,
bioRxiv - Physiology 2022
Quote:
... Surface GLUT1 and SLC7A1 expressions were monitored by binding to their retroviral envelope ligand (RBD) fused to eGFP for GLUT1 (1:25 dilution in 50 µls; Metafora biosystems) or to the RBD-rFc fusion protein for SLC7A1 (1:25 dilution in 50 µl ...
-
No products found
because this supplier's products are not listed.
Adithya Ramesh, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... and 4 were cloned into the AarI digested pCas9yl-GW vector using the Gibson Assembly HiFi HC 1-step Master Mix (SGI-DNA). Library 2 was digested with AarI and cloned into pCas9yl-GW digested with AarI using Golden Gate assembly with T4 DNA ligase (NEB).
-
No products found
because this supplier's products are not listed.
Gino Del Ferraro, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Neural signals from all channels were simultaneously amplified and digitized at 30 kHz with 16 bits of resolution with the lowest significant bit equal to 1 uV (NSpike, Harvard Instrumentation Lab; unit gain headstage ...
-
No products found
because this supplier's products are not listed.
Zhouyi Rong, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Mouse Interleukin 6 (IL6) ELISA Kit (RD-IL6-Mu, Reddot biotech), Mouse Interferon Gamma Induced Protein 10kDa (IP10 ...
-
No products found
because this supplier's products are not listed.
Ying Zhan, et al.,
bioRxiv - Bioengineering 2019
Quote:
... Acid-terminated PLGA (Mw: 25,000 g mol−1, 50:50 lactic acid:glycolic acid, acid end‐capped, Akina Inc. PolySciTech, West Lafayette, IN) was dissolved with dimethylformamide (DMF ...
-
No products found
because this supplier's products are not listed.
Kathleen L. Arnolds, et al.,
bioRxiv - Microbiology 2023
Quote:
Mesocosm experiments were conducted in 3D-printed pots (S. Fig. 1) that have 18 sampling ports which are sealed with neoprene stoppers (Eisco Labs, Victor, NY). A perforated base allows for root development ...
-
No products found
because this supplier's products are not listed.
Lucas Albrechet-Souza, et al.,
bioRxiv - Animal Behavior and Cognition 2019
Quote:
... The apparatus was thoroughly cleaned between animals with Quatricide® PV in water at a concentration of 1:64 (Pharmacal Research Labs, Waterbury, CT). For each rat ...
-
No products found
because this supplier's products are not listed.
Rani Cathrine. C, Bincy Lukose, P. Rani,
bioRxiv - Neuroscience 2019
Quote:
... PCR was performed and the product was purified from the 1% agarose gel using HiYield™ Gel/PCR DNA Mini Kit (Real Biotech Corporation, Taiwan).
-
No products found
because this supplier's products are not listed.
Hao Wang, et al.,
bioRxiv - Biochemistry 2024
Quote:
The gel was prepared with a concentration of 6% (wt/vol) agarose (HydraGene Co. ...
-
No products found
because this supplier's products are not listed.
Hayden A. M. Hatch, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The dSO vial was immediately cleared and placed in one arm of a T-maze (CelExplorer Labs) and an empty vial in another ...
-
No products found
because this supplier's products are not listed.
Erica Misner, Min Zhang, Eva Sapi,
bioRxiv - Microbiology 2022
Quote:
... PCR products were analyzed by standard agarose gel electrophoresis in a 1% gel referenced against a Hi-Lo DNA ladder (Bionexus, Inc., Oakland, CA, USA; BN2050). An infected zebrafish sample which was positive for B ...
-
No products found
because this supplier's products are not listed.
Elaheh Movahed, et al.,
bioRxiv - Immunology 2022
Quote:
... Those samples were submitted for Lyme disease serology and subjected to two-tiered testing consisting of (Tier 1) a C6 peptide screen (Immunetics®; C6 Lyme ELISA™) or Enzyme Linked Fluorescent Assay (ELFA ...
-
No products found
because this supplier's products are not listed.
Matthew L. Fabian, et al.,
bioRxiv - Plant Biology 2022
Quote:
... Aliquots of 1 μL of TRV1 and recombinant TRV2 were electroporated into 50 μL tubes of Agrobacterium tumifasciens strain GV3101 cells (Intact Genomics, St. Louis MO, USA) using a Bio-Rad Gene Pulser II and Pulse Controller electroporation system set to 2.2 kV ...
-
No products found
because this supplier's products are not listed.
Niraj Mishra, et al.,
bioRxiv - Microbiology 2019
Quote:
... they were resuspended in FACS-B and filtered through 100 μm nylon meshes (Sefar, ELKO Filtering, 03-100/44) prior to analysis on a flow cytometer (LSR Fortessa X-20 ...
-
No products found
because this supplier's products are not listed.
Xiao Lin, et al.,
bioRxiv - Plant Biology 2020
Quote:
A BAC library of plant GIG362-6 was generated by Bio S&T (Canada). A BAC clone that spans the mapping interval was isolated using molecular markers (Table S2 ...
-
No products found
because this supplier's products are not listed.
Josée Perreault, et al.,
bioRxiv - Immunology 2020
Quote:
... The plates were incubated once again for one hour at RT followed by washing and addition of 100 μl of 3,3’,5,5’-Tetramethylbenzidine (TMB, ESBE Scientific). The colorimetric reaction proceeded for 20 minutes at RT and was stopped by addition of 100 μl of H2SO4 1N (Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Mariano A. Ostuni, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 20 glycerol and with 5 Critical Micellar Concentration of CALX173ACE (CALIXAR). CALX173ACE solubilized CX3CL1 was loaded into magnetic beads previously crosslinked to polyclonal anti-CX3CL1 antibody using an IP kit (Pierce ...
-
No products found
because this supplier's products are not listed.
Jessica L. Kelliher, et al.,
bioRxiv - Microbiology 2023
Quote:
... Endpoint kinase assays were performed by mixing 3 μg purified PrkA1- 338 with the indicated combinations of ∼3x molar excess of substrate to kinase (6 μg of the generic kinase substrate myelin basic protein [MBP; Novatein Biosciences, Woburn ...
-
No products found
because this supplier's products are not listed.
Yalda Afshar, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Confluent endothelial monolayers were grown on tissue culture treated 6-well plates (Falcon #08-772-1B) in complete MCDB-131 media (VEC Technologies # MCDB131-WOFBS) plus 10% FBS (Omega Scientific #FB-11 ...
-
No products found
because this supplier's products are not listed.
Colin Kremitzki, et al.,
bioRxiv - Genetics 2023
Quote:
Lentiviruses carrying the gRNA libraries were packaged into 8×106 HEK 293T cells/well in a 6-well plate (TPP92006, MIDSCI, Fenton, MO, USA), using the TransIT Lentivirus transfection reagent (MIR 6600 ...
-
No products found
because this supplier's products are not listed.
Filipy Borghi, et al.,
bioRxiv - Physiology 2021
Quote:
... 4 °C and analyzed using the commercial ELISA kit (Diagnostics Biochem Canada Inc. - Ref CAN-C-290) at the Laboratory of Stress Studies (LABEEST ...
-
No products found
because this supplier's products are not listed.
Erika Flores, et al.,
bioRxiv - Microbiology 2023
Quote:
... and 5 μL of each dilution was plated on CHROMagar™ O157 plates (Drg International Inc). The plates were incubated at 30 °C for 24 h ...
-
No products found
because this supplier's products are not listed.
Romain Lanotte, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Cells were then transiently transfected with 5 μg of each construct using Metafectene (Biontex Lab.; München, Germany), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Charlène Iltis, et al.,
bioRxiv - Immunology 2021
Quote:
... membranes were stripped at 4°C in agitation using Antibody stripping buffer 1X for 10 minutes (Gene Bio-Application). Protein bands were quantified using ImageJ software ...
-
No products found
because this supplier's products are not listed.
Minsuk Kong, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... Increasing ratios (multiplicities of incubation ranging from 20 to 150) of SSHELαHER2 (labeled with AlexaFluor647) were incubated with 5 × 105 cells/ml in siliconized tubes (G-tubes, Bio Plas Inc.) for 1 h at 37 °C with gentle inversion ...
-
No products found
because this supplier's products are not listed.
Elizabeth C. Townsend, et al.,
bioRxiv - Microbiology 2023
Quote:
... the samples were stained with a PNA-FISH-TexasRed-5-conjugated universal bacterial (BacUni) 16s rRNA probe (AdvanDx, Woburn, MA, US), incubated and then counterstained with 3 µM 4′,6-diamidino-2-phenylindole (DAPI ...
-
No products found
because this supplier's products are not listed.
Dorothee Jakob, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... we applied the spider toxin peptide Grammostola spatulata mechanotoxin 4 (GsMTx4) L-isomer (10 μmol/L, H20 as solvent, CSBio, Menlo Park, CA, USA), a known blocker of cation non-selective SAC ...
-
No products found
because this supplier's products are not listed.
Devin Rocks, et al.,
bioRxiv - Neuroscience 2023
Quote:
... n=5/sex/group) were rinsed with distilled water and underwent the Golgi-Cox staining procedure (Golgi-Cox OptimStain Kit, Hitobiotec Inc. #HTKNS1125) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Angus M Sidore, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... The individual wells were then washed >5 times using 2X Bind & Wash Buffer and a 384-Well Post Magnetic Plate (Permagen Labware, Peabody, MA). After washing ...
-
No products found
because this supplier's products are not listed.
Rebecca C.S. Edgar, et al.,
bioRxiv - Microbiology 2023
Quote:
... Venous blood (5 mL) was collected by venipuncture and after removal of host white blood cells using Plasmodipur filters (EuroProxima B.V., The Netherlands), packed infected red blood cells (iRBCs ...
-
7H-Azeto[2,1-b]-1,3-dioxino[4,5-e][1,3]oxazin-7-one,hexahydro-2,6-dimethyl-,(2s,4ar,5as,6s,9ar)-(9ci)
Cat# ACM785051801,
Inquire
No citation found on bioRxiv
-
Cat# CDC10-0387,
1 kg, Inquire for price
No citation found on bioRxiv
-
No citation found on bioRxiv