-
No products found
because this supplier's products are not listed.
Michael A. Sullivan, et al.,
bioRxiv - Neuroscience 2022
Quote:
... iPSCs were cultured with the addition of 10 ng/mL StemBeads fibroblast growth factor 2 (FGF-2) (StemCultures). Upon reaching 80 % confluency ...
-
Peptide to PAR-3 (1-6) (Human)
Cat# CCP2734,
1 mg USD $100.0, 5 mg USD $250.0, 10 mg USD $375.0
Ask
Huy-Dung Hoang, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The following primary antibodies and corresponding dilution were used: 1:500 α-INPP5E (# CPA3073, Cohesion Biosciences), 1:10,000 α-β-actin (#A5441 ...
-
No products found
because this supplier's products are not listed.
Colin Kremitzki, et al.,
bioRxiv - Genetics 2023
Quote:
Lentiviruses carrying the gRNA libraries were packaged into 8×106 HEK 293T cells/well in a 6-well plate (TPP92006, MIDSCI, Fenton, MO, USA), using the TransIT Lentivirus transfection reagent (MIR 6600 ...
-
No products found
because this supplier's products are not listed.
Pengchao Wang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... for 2 min and then subjected to the imaging system (UVITEC Cambridge) to record signals.
-
No products found
because this supplier's products are not listed.
Laura Ohl, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Tissue was mixed with 1 mL 40:40:20 methanol:acetonitrile:water (extraction solvent) and homogenized with a benchtop lyser (SciLogex OS20-S) at 1600 mhZ for approximately 15 sec ...
-
No products found
because this supplier's products are not listed.
Marlene Corbet, et al.,
bioRxiv - Pathology 2020
Quote:
... male DBA/1 mice (8-weeks old) were injected intradermally on day 0 with 100 µg Bovine Type II collagen (CII; MD biosciences) in complete Freunds adjuvant (CFA ...
-
No products found
because this supplier's products are not listed.
Adithya Ramesh, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... and 4 were cloned into the AarI digested pCas9yl-GW vector using the Gibson Assembly HiFi HC 1-step Master Mix (SGI-DNA). Library 2 was digested with AarI and cloned into pCas9yl-GW digested with AarI using Golden Gate assembly with T4 DNA ligase (NEB).
-
No products found
because this supplier's products are not listed.
Ying Zhan, et al.,
bioRxiv - Bioengineering 2019
Quote:
... Acid-terminated PLGA (Mw: 25,000 g mol−1, 50:50 lactic acid:glycolic acid, acid end‐capped, Akina Inc. PolySciTech, West Lafayette, IN) was dissolved with dimethylformamide (DMF ...
-
No products found
because this supplier's products are not listed.
Kathleen L. Arnolds, et al.,
bioRxiv - Microbiology 2023
Quote:
Mesocosm experiments were conducted in 3D-printed pots (S. Fig. 1) that have 18 sampling ports which are sealed with neoprene stoppers (Eisco Labs, Victor, NY). A perforated base allows for root development ...
-
No products found
because this supplier's products are not listed.
Charlène Iltis, et al.,
bioRxiv - Immunology 2021
Quote:
... membranes were stripped at 4°C in agitation using Antibody stripping buffer 1X for 10 minutes (Gene Bio-Application). Protein bands were quantified using ImageJ software ...
-
No products found
because this supplier's products are not listed.
Lucas Albrechet-Souza, et al.,
bioRxiv - Animal Behavior and Cognition 2019
Quote:
... The apparatus was thoroughly cleaned between animals with Quatricide® PV in water at a concentration of 1:64 (Pharmacal Research Labs, Waterbury, CT). For each rat ...
-
No products found
because this supplier's products are not listed.
Rani Cathrine. C, Bincy Lukose, P. Rani,
bioRxiv - Neuroscience 2019
Quote:
... PCR was performed and the product was purified from the 1% agarose gel using HiYield™ Gel/PCR DNA Mini Kit (Real Biotech Corporation, Taiwan).
-
No products found
because this supplier's products are not listed.
Kathleen M.E. Gallagher, et al.,
bioRxiv - Immunology 2021
Quote:
A qualitative ELISA for Human Anti-IgG/A/M SARS-CoV-2 ELISA (The Binding Site) was performed using donor serum per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Erica Misner, Min Zhang, Eva Sapi,
bioRxiv - Microbiology 2022
Quote:
... PCR products were analyzed by standard agarose gel electrophoresis in a 1% gel referenced against a Hi-Lo DNA ladder (Bionexus, Inc., Oakland, CA, USA; BN2050). An infected zebrafish sample which was positive for B ...
-
No products found
because this supplier's products are not listed.
Elaheh Movahed, et al.,
bioRxiv - Immunology 2022
Quote:
... Those samples were submitted for Lyme disease serology and subjected to two-tiered testing consisting of (Tier 1) a C6 peptide screen (Immunetics®; C6 Lyme ELISA™) or Enzyme Linked Fluorescent Assay (ELFA ...
-
No products found
because this supplier's products are not listed.
Matthew L. Fabian, et al.,
bioRxiv - Plant Biology 2022
Quote:
... Aliquots of 1 μL of TRV1 and recombinant TRV2 were electroporated into 50 μL tubes of Agrobacterium tumifasciens strain GV3101 cells (Intact Genomics, St. Louis MO, USA) using a Bio-Rad Gene Pulser II and Pulse Controller electroporation system set to 2.2 kV ...
-
No products found
because this supplier's products are not listed.
Nishith M Shrimali, et al.,
bioRxiv - Pathology 2021
Quote:
... and incubated with collagen (10 µg/ml) or ADP (2 µM, both from the Bio/Data Corporation, USA) 10 minutes ...
-
No products found
because this supplier's products are not listed.
Gregory M Wright, et al.,
bioRxiv - Cell Biology 2023
Quote:
... FISH was performed using probes for the MT locus in 16q12.2 (56,396,107 to 56,782,063 on chromosome 16 in GRCh37) and chromosome 16 α-satellite purchased from Oxford Gene Technology, who performed paired-end sequencing to verify the identity of the BACs ...
-
No products found
because this supplier's products are not listed.
Dorothee Jakob, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... we applied the spider toxin peptide Grammostola spatulata mechanotoxin 4 (GsMTx4) L-isomer (10 μmol/L, H20 as solvent, CSBio, Menlo Park, CA, USA), a known blocker of cation non-selective SAC ...
-
No products found
because this supplier's products are not listed.
Neil J Rzechorzek, et al.,
bioRxiv - Biochemistry 2020
Quote:
... HEK293-F cells were grown in 400 mL batches in 2 L non-baffled Erlenmeyer flasks (TriForest Enterprises Inc, #FPC2000S) to a cell density of ∼1×106 cells/mL.
-
No products found
because this supplier's products are not listed.
Shengyun Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...
-
No products found
because this supplier's products are not listed.
Stanimir S. Ivanov, et al.,
bioRxiv - Microbiology 2021
Quote:
The human monocytic cell line U937 (ATCC CRL-1593.2) was obtained from ATCC and primary human peripheral monocytic cells (PBMCs) from two different donors were purchased from Precision for Medicine. U937 cells were cultured in RPMI 1640 media (VWR ...
-
No products found
because this supplier's products are not listed.
Neha E. H. Dinesh, et al.,
bioRxiv - Cell Biology 2023
Quote:
... For sanger sequencing PCR reactions were performed using specific oligos against the target FN domains (Supp Table 2) and Taq DNA Polymerase kit (ZmTech Scientifique; Catalogue #T207025) and analyzed on 2% agarose gels ...
-
No products found
because this supplier's products are not listed.
Carmen RB da Silva, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... The volumetric flow rates produced by the flow controllers was measured using a Gilian Gilibrator–2 NIOSH Primary Standard Air Flow Calibrator with a low–flow cell (Sensidyne, LP, St Petersburg, FL, USA) and corrected to standard temperature pressure ...
-
Cat# ACM65427841,
Inquire
No citation found on bioRxiv
-
Cat# CDC10-0443,
10 g, Inquire for price
No citation found on bioRxiv
-
No citation found on bioRxiv
-
Cat# DIA-0231387,
Inquiry
No citation found on bioRxiv
-
Catalog Number: B2011420 (5 mg)
DACM (N-(7-Dimethylamino-4-methylcoumarin-3-yl)maleimide) is a...
Cat# B2011420,
USD $595.0
No citation found on bioRxiv
-
Cat# RN-1403,
1 g; 5 g; 10 g, Inquire
No citation found on bioRxiv
-
Cat# MEVs-470,
1 vial, USD $1,355
No citation found on bioRxiv
-
3-Hydroxypicolinic Acid (3-HPA) is a matrix for use in the analysis of oligonucleotides by...
Cat# CPAS100020,
inquiry, contact supplier for pricing
No citation found on bioRxiv
-
Graphene Thickness: 1~3nm
Layers: <3
Graphene Average Particle Diameter: 2~10um
Graphene Surface...
Cat# GRA-230,
1 g, USD $360.0
No citation found on bioRxiv
-
SeedEZ 3D cell culture scaffold for 6 well plates (pack of 6 scaffolds)
Cat# SC-C006-0006,
6 case, $228.00
No citation found on bioRxiv