-
No products found
because this supplier's products are not listed.
Nargis Parvin Laha, et al.,
bioRxiv - Plant Biology 2020
Quote:
... pH 5.7 and 0.06 nCi mL−1 of [3H]-indole-3-acetic acid (15 to 30 Ci mmol−1; Biotrend; ART 0340). The excised stems were incubated in the solution for different time points ...
-
No products found
because this supplier's products are not listed.
Lawrence G. Welch, et al.,
bioRxiv - Cell Biology 2024
Quote:
... CD19+ B-cells (HemaCare, US) were cultured in B cell Excellerate medium with the CEllXVivo B cell expansion kit (R&D systems ...
-
No products found
because this supplier's products are not listed.
Huifang Bai, et al.,
bioRxiv - Zoology 2021
Quote:
... Records were selected systematically from 7 databases (Medline via to Pubmed ...
-
No products found
because this supplier's products are not listed.
Rachel L. Neve, et al.,
bioRxiv - Microbiology 2021
Quote:
... 2-heptylquinolin-4(1H)-one (HHQ, Ark Pharm); 2-heptyl-4-hydroxyquinoline N-oxide (HQNO ...
-
No products found
because this supplier's products are not listed.
Sarah A. Ware, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Pools B-E were purchased (BioIVT, Hicksville, NY, USA). Each lot was aliquoted and stored at -80 °C.
-
No products found
because this supplier's products are not listed.
Daniela Niemeyer, et al.,
bioRxiv - Microbiology 2021
Quote:
... and B.1.351-HRP-RBD (provided by Medac, Wedel, Germany) solution and incubated at 37°C for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Mark K. Adams, et al.,
bioRxiv - Systems Biology 2019
Quote:
... One mL of FBS (Peak Serum, Inc, Wellington CO) was added the next morning ...
-
No products found
because this supplier's products are not listed.
Savannah J. Ryburn, et al.,
bioRxiv - Genetics 2023
Quote:
... and Sanger sequenced in one direction by Eton Bioscience in Durham ...
-
No products found
because this supplier's products are not listed.
Navid Farhoudi, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 19.1 mg of 3-aminophenylboronic acid (3-APB, Frontier Scientific) was dissolved in 87 µL of dimethyl sulfoxide (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Kristen A. Gaffney, et al.,
bioRxiv - Biophysics 2021
Quote:
... iodoacetyl-7-nitrobenz-2-oxa-1,3-diazol (IA-NBD, Setareh Biotech) (42) ...
-
No products found
because this supplier's products are not listed.
Ivan Vujkovic-Cvijin, et al.,
bioRxiv - Immunology 2021
Quote:
... Resulting suspensions were plated on YCFAC+B (Anaerobe Systems, #AS-677), MTGE (Anaerobe Systems ...
-
No products found
because this supplier's products are not listed.
John DeSisto, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... FGF and PDGF A/B at 20 ng/μL (Shenandoah Biotechnology). Cells were passaged as required by trituration to break up the neurospheres and replacement of the medium.
-
No products found
because this supplier's products are not listed.
Kari Martyniak, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 5.832g, Oakwood Chemical) were added to the solution under stirring to activate 30 % of the carboxylic acids of the oxidized alginate ...
-
No products found
because this supplier's products are not listed.
Alex M. Jaeger, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 3 µM CHIR99021 (AbMole), 1 µM PD0325901(AbMole)] ...
-
PRG-3 and Attachment Factor™ are engineered to work together to stabilize the cell membrane and...
Cat# 4Z0-410,
100.0 mL, $82.0
Ask
Jessica Migliavacca, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... coated overnight with 0.07 μg/μl collagen I (5005-B, Cell systems) diluted in 70% EtOH ...
-
No products found
because this supplier's products are not listed.
Lily R. Zehfus, et al.,
bioRxiv - Plant Biology 2021
Quote:
... Quercetin-3-O-glucoside and isorhamnetin-3-O-glucoside were obtained from Indofine Chemical Company ...
-
No products found
because this supplier's products are not listed.
Sabrina X. Van Ravenstein, et al.,
bioRxiv - Biochemistry 2022
Quote:
... TOP2β (Topogen, Cat# tg2010-3).
-
No products found
because this supplier's products are not listed.
Mirjana Grujic, et al.,
bioRxiv - Immunology 2022
Quote:
... and 3 µl Draq7 (Biostatus, Shepshed Leicestershire ...
-
No products found
because this supplier's products are not listed.
Esther Martínez-Martínez, et al.,
bioRxiv - Biochemistry 2021
Quote:
... and B (0.5% acetic acid in 80% acetonitrile; LGC Standards-Promochem, Wesel, Germany) with increasing organic proportion was used for peptide separation ...
-
No products found
because this supplier's products are not listed.
Koray D. Kaya, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Thin-sections (70 to 80nm) were made with an ultramicrotome (UC 7) and diamond knife (Diatome), attached on 200-mesh copper grid ...
-
No products found
because this supplier's products are not listed.
James Peak, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and Fluorogold (FG; 3% in saline; Fluorochrome) into the GPe and SNr ...
-
No products found
because this supplier's products are not listed.
Wren E. Michaels, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Quantitative analysis of the CFTR B and C-bands was performed using Compass software (Protein Simple).
-
No products found
because this supplier's products are not listed.
Sebastian Jusuf, et al.,
bioRxiv - Microbiology 2020
Quote:
... GBS (ATCC 12386) was grown in New Granada Media/Strep B Carrot Broth (Z40, Hardy Diagnostics) at 37°C for 48 to 72 hours until the broth turned a rich orange-red color ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Membranes were blocked in skim milk and incubated with anti-MASP-3 mAb 38:12-3 (Hycult Biotech, HM2216) for 1.5h at RT and HRP-conjugated rabbit anti-rat (Agilent ...
-
No products found
because this supplier's products are not listed.
Maja Gehre, et al.,
bioRxiv - Genetics 2019
Quote:
... Lysis buffer was prepared by diluting one part direct-lysis reagent (301-C, Viagen Biotech) in two parts destilled water (e.g ...
-
No products found
because this supplier's products are not listed.
Qiong Wang, et al.,
bioRxiv - Immunology 2019
Quote:
One immunization to induce CIA : Bovine type II collagen (2 mg/ml, Chondrex, cat. # 20021) and complete Freund’s adjuvant (4mg/ml M ...
-
No products found
because this supplier's products are not listed.
Nobunao Ikewaki, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... 3’-diaminobenzidine/H2O2 solution (Nichirei Bioscience Inc., Japan). The primary antibody used was monoclonal antibody to mouse macrophages (BMA Biomedicals ...
-
No products found
because this supplier's products are not listed.
Marc-Joseph Antonini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and Ag/AgCl electrode (BASi, 3 M NaCl) were used as the counter and reference electrodes ...
-
No products found
because this supplier's products are not listed.
Michael B. Geary, et al.,
bioRxiv - Pathology 2022
Quote:
... and the skin was closed with either 7 mm stainless steel wound clips (CellPoint Scientific Inc., Gaithersburg, MD) or a series of interrupted 5-0 nylon sutures ...
-
No products found
because this supplier's products are not listed.
Ramona Haji-Seyed-Javadi, et al.,
bioRxiv - Molecular Biology 2023
Quote:
ChIP assay was performed using ChromaFlashTM One-Step ChIP Kit (P-2025, Epigentek, Farmingdale, NY, USA) according to the manufacture’s instruction ...
-
No products found
because this supplier's products are not listed.
S. Sanchez-Martinez, et al.,
bioRxiv - Physiology 2023
Quote:
Quantitated and lyophilized protein samples were transferred as powder into NMR tubes (Catalog WG-4001-7, Bel-Art Products) and resuspended in 500 µL of water to final concentrations of 5 g/L ...
-
No products found
because this supplier's products are not listed.
Thomas M. Winkelmüller, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 800 µl of 3 µM flg22 (EZBiolab Inc., USA) solution was added to the medium containing the seedlings resulting in a final concentration of 1 µM flg22 ...
-
No products found
because this supplier's products are not listed.
Chiaki Imanaka, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3% bovine serum albumin (BAC62, Equitech-Bio, Kerrville, TX), and 0.02% polyoxyethylene sorbitan monolaurate (166–21115 ...
-
No products found
because this supplier's products are not listed.
Jaqueline S. Generoso, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rabbit polyclonal anti-capsule serotype 3 antiserum (SSI Diagnostica) followed by Alexa Fluor 594 goat anti-rabbit (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Marie-Françoise Montaron, et al.,
bioRxiv - Neuroscience 2020
Quote:
One-of-ten series was incubated with a rat monoclonal anti-BrdU antibody (1/200, Accurate Chemical) and with a mouse monoclonal anti-NeuN antibody (1:500 ...
-
No products found
because this supplier's products are not listed.
Phillip Nußbaum, et al.,
bioRxiv - Microbiology 2020
Quote:
... One ml of the nutrition pad solution was poured in a round Delta T Dish (Bioptechs Inc.). After the pad had solidified 3 µl of cells in very early exponential phase (OD600 0.05-0.1 ...
-
No products found
because this supplier's products are not listed.
Shanti Pal Gangwar, et al.,
bioRxiv - Biophysics 2019
Quote:
Crystallization screening was performed with GLR3.2-S1S2 protein at a concentration of ~7 mg/ml using Mosquito robot (TTP Labtech) and sitting drop vapor diffusion in 96-well crystallization plates ...
-
No products found
because this supplier's products are not listed.
Esther Cañibano, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 2 ug total RNA extracted from 7 day old seedlings with the Favorprep Plant Total RNA Purification Mini kit (Favorgen) was used for cDNAs synthesis with using the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems ...
-
No products found
because this supplier's products are not listed.
Marina Barba-Aliaga, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and mixed with one volume of glass beads for further homogenization in a Precellys tissue homogenizer (Bertin Corp.). Lysates were cleared by centrifugation at 12000 rpm for 5 min at 4°C and protein extracts were assayed for firefly and Renilla luciferase activity sequentially in a 96-well luminometry plate (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Clara Alameda, et al.,
bioRxiv - Neuroscience 2023
Quote:
... participants were fitted with 3-ECG electrodes (Ambu, Ballerup, Denmark) and a 64-channel actiCHamp EEG system (Brain Products ...
-
No products found
because this supplier's products are not listed.
Rebekka Karlowitz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... mouse anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (5G4cc, HyTest, Turku, Finland), mouse anti-Vinculin (#V9131-100UL ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Sara C. Di Rienzi, et al.,
bioRxiv - Microbiology 2022
Quote:
... 3-inch needle (N163D, Air-Tite Vet Premium Hypodermic Needles, USA) positioned at the level within the glass reactor such that the media level was at 15 mls ...
-
No products found
because this supplier's products are not listed.
Mary Kefi, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... After validation of recombinant protein expression of expected size in Sf9 cells and determination of viral stock titers using baculoQUANT ALL-IN-ONE (GenWay), according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Pooja Gupta, et al.,
bioRxiv - Biochemistry 2021
Quote:
... An initial crystallization condition was identified I the Wizards Classic 3&4 crystallisation screen (Rigaku), well F2 (40% PEG400 ...
-
No products found
because this supplier's products are not listed.
Brynna S. Eisele, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The volume of concentrated samples was adjusted to 70 ul and 3 ul of Chondroitinase ABC (1.4 U/ml Stock solution, containing BSA, Seikagaku) was added to each sample ...
-
No products found
because this supplier's products are not listed.
Cameron J Glasscock, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... 50 μL of overnight cells were added to 1.95 mL of complete R-media (Supplementary Tables 5-7) and appropriate antibiotics in glass hungate tubes (ChemGlass). 0.1 mM IPTG was added for induction of the upstream pathway enzymes and p5Trc/p10Trc expression ...
-
No products found
because this supplier's products are not listed.
Tise Suzuki, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... One thousand PDX4 cells were seeded in triplicates in flat-bottomed 96-well plates (229195; CELLTREAT Scientific Products) and allowed to adhere for 24 hours prior to the addition of cisplatin or Olaparib (AZD2281 ...
-
No products found
because this supplier's products are not listed.
Prashant Gupta, et al.,
bioRxiv - Bioengineering 2022
Quote:
... in 3 ml of Hibernate E-Ca (HE-Ca, BrainBits, USA) for 10 minutes at 30°C ...
-
No products found
because this supplier's products are not listed.
Wenli Yang, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 8-(4-Chlorophenylthio)-2’-O- methyladenosine-3’,5’-cyclic monophosphate acetoxymethyl ester (007-AM) was from Axxora (Cat. # BLG-C051). DAPI (Cat ...