-
No products found
because this supplier's products are not listed.
Clara J. Amorosi, et al.,
bioRxiv - Genomics 2021
Quote:
... Hex-5-yn-1-amine was purchased from GFS Chemicals (Powell, OH).
-
No products found
because this supplier's products are not listed.
Yuan-Chen Tsai, et al.,
bioRxiv - Neuroscience 2022
Quote:
... AP-5 (50 μM, almone labs) and tetrodotoxin (1 μM, Affix Scientific). 10 min after establishing the whole-cell mode ...
-
No products found
because this supplier's products are not listed.
Lucy I. Crouch, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Control samples were digested with PNGase F (1 μl, 5 mU, QA-Bio) For Pngase-003341 the final enzyme concentration was 1 μM ...
-
No products found
because this supplier's products are not listed.
Seokho Kim, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Active GLP-1 (7-36) was measured using the Mouse / Rat GLP-1 Active (7-36) ELISA Kit (Eagle Biosciences, GP121-K01).
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Olga Puchta, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
Microarray imaging was performed in an imaging buffer solution containing fluorophore DFHBI-1T ((Z)-4-(3,5-difluoro-4-hydroxybenzylidene)-2-methyl-1-(2,2,2-trifluoroethyl)-1Himidazol-5(4 H)-one) (excitation = 472 nm, emission = 507 nm)) from Lucerna Technologies Cat ...
-
No products found
because this supplier's products are not listed.
Wenfeng Zeng, et al.,
bioRxiv - Immunology 2022
Quote:
... 5×104 BMDCs were pulsed with 1 mg/ml endotoxin-free chicken egg ovalbumin (OVA, Hyglos GmbH, Germany) in the presence of 50 μg/ml MC38 TEVs or MLC-V ...
-
No products found
because this supplier's products are not listed.
Kevin N. Lin, Albert J. Keung, James M. Tuck,
bioRxiv - Synthetic Biology 2019
Quote:
Oligos were purchased with a 5’ biotin modification (Eton Bioscience). Toehold strands were diluted to 1011 strands and mixed with biotinylated oligos at a ratio of 1:40 in a 50 µL reaction containing 2 mM MgCl2 (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Carlos Theodore Huerta, et al.,
bioRxiv - Bioengineering 2024
Quote:
... LacZ/Lentiviral vector plasmid and Luc2/Lentiviral vector plasmid were described previously.5 Human ICAM-1/Lentiviral vector was purchased from GenTarget Inc ...
-
No products found
because this supplier's products are not listed.
Maryann P. Platt, et al.,
bioRxiv - Microbiology 2022
Quote:
... The membrane was then blocked with 5% BSA in TBS with 0.05% Tween-20 and probed overnight with anti-pneumococcus capsular antibody (1:500, SSI Diagnostica cat. 16747). Membranes were washed extensively ...
-
No products found
because this supplier's products are not listed.
Maik Müller, et al.,
bioRxiv - Systems Biology 2020
Quote:
... Peptides were C18-purified using 5–60 μg UltraMicroSpin Columns (The Nest Group, cat: SEMSS18V) according to manufacturer’s instructions and subjected for mass spectromic analysis using an Orbitrap Fusion Tribrid mass spectrometer (Thermo Scientific ...
-
No products found
because this supplier's products are not listed.
Kota Kaneko, et al.,
bioRxiv - Cell Biology 2023
Quote:
... PLC/PRF/5 cells were treated with HGF and SHP099 (10 μM; CHEMIETEK; CT-SHP099) or trametinib (10 nM ...
-
No products found
because this supplier's products are not listed.
Elizaveta O. Boldinova, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Primer-18 was 5′-labeled with [γ-32P]-ATP by T4 polynucleotide kinase (SibEnzyme, Russia) and annealed to the corresponding unlabeled Template-55 at a molar ratio of 1:1.1 ...
-
No products found
because this supplier's products are not listed.
Alessandro Dema, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 5% CO2 in a humidified tissue culture incubator and regularly tested for mycoplasma contamination (IDEXX BioResearch). H1299 cells and sublines were previously authenticated by STR profiling [7] ...
-
No products found
because this supplier's products are not listed.
Jia J. Li, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... slides were incubated in 95% ethanol for 5 min and counterstained with Eosin (Poly Scientific S1761GL) for 1-3 min ...
-
No products found
because this supplier's products are not listed.
Hajar Mikaeili, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 7-10 µm thick) and Human Prostate Frozen Sections (HF-408, 7-10 µm thick) were obtained commercially from Zyagen (www.zyagen.com) via AMS Biotechnology (https://www.amsbio.com ...
-
Native Antigen
Cat# AH01-100,
100µg USD $289.0
Ask
Fakhriedzwan Idris, et al.,
bioRxiv - Microbiology 2024
Quote:
... 5 mg/kg of purified NS1(D2Y98P or de-glycosylated T209L) (custom-made, The Native Antigen Company) or OVA protein (InvivoGen ...
-
Aldosterone ELISA / assay Kit
Cat# K052-H5,
1.0 ea, USD $1285.0
Ask
Lara S. Hwa, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 5 µl plasma samples were processed with a commercially available colorimetric ELISA kit (Arbor Assays, Ann Arbor, MI), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Jessica Hunter, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... The infection was then separated into infected cells and cell-free virus by centrifugation at 300 g for 5 minutes followed by filtration of the supernatant through a 0.45 micron filter (GVS). 1.2 × 106 infected cells or supernatant from 1.2 × 106 infected cells were added to new uninfected target cells such that the final number of cells in the culture was 6 × 106 at a concentration of 1 × 106cells/ml ...
-
No products found
because this supplier's products are not listed.
Athanasios Papadas, et al.,
bioRxiv - Immunology 2021
Quote:
Paraffin-embedded murine tumor sections and unstained 4-5 μm-thick human lung carcinoma TMA (US Biomax Inc., BC041115e) sections were deparaffinized and rehydrated using standard methods ...
-
No products found
because this supplier's products are not listed.
Elizabeth B. Draganova, et al.,
bioRxiv - Biophysics 2023
Quote:
... Reactions incubated for 5 min at 20 °C before imaging in 96-well chambered coverglass (Brooks Life Science Systems). Samples were imaged using a Nikon A1R Confocal Microscope with a 60x oil immersion lens at the Imaging and Cell Analysis Core Facility at Tufts University School of Medicine ...
-
No products found
because this supplier's products are not listed.
Kishor Dnyaneshwar Ingole, et al.,
bioRxiv - Plant Biology 2020
Quote:
... The membrane was blocked with 5% non-fat skim milk and western blots performed with indicated primary antibodies [anti-SNC1 (Abiocode), anti-PR1 or anti-PR2 (Agrisera) ...
-
No products found
because this supplier's products are not listed.
Mubasher Mohammed, et al.,
bioRxiv - Microbiology 2022
Quote:
... Mosquito midguts were collected in 1.5 ml Eppendorf tubes with 500μl of RPMI and homogenized using a micro-tube homogenizer (F65000-0000, SP-Bel-Art) at short intervals for 30 seconds ...
-
No products found
because this supplier's products are not listed.
Lauren G. Buss, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Cells were exposed to a single dose of 5 Gy irradiation (X-ray, RS 2000 Small Animal Irradiator, Rad Source). The untreated cells were shielded with >6 mm lead.
-
No products found
because this supplier's products are not listed.
Yana Roka-Moiia, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 5 mM CaCl2) were incubated with 200 nM acetylated prothrombin and 100 pM factor Xa (Enzyme Research Laboratories, South Bend, IN) in 20 mM HEPES buffer (pH 7.4) ...
-
No products found
because this supplier's products are not listed.
Shruti D Shah, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... samples were embedded in paraffin and sectioned at 5 microns on Starfrost adhesive slides (Mercedes Medical; Catalog #MER 7255/90/WH). Slides were deparaffinized in three xylene baths and then rehydrated in graded 100% to 70% alcohols ...
-
No products found
because this supplier's products are not listed.
Ana Belen Lopez-Rodriguez, et al.,
bioRxiv - Neuroscience 2022
Quote:
... mice (n=6) underwent stereotaxic surgery to implant MBR-5 intracerebral guide cannulae (ID 457μm, OD 635 μm; BASi Research Products, USA) into the striatum ...
-
Cat# AB-T080,
50 microliters,USD $330.0
Ask
Joël S. Bloch, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... the biotinylated samples were desalted into PBS and were mixed at a concentration of 5 μM with a 2.4-fold molar excess of Streptavidin-ZAP (Advanced Targeting Systems, Carlsbad, CA, USA). The mixture was incubated for 1h on ice before diluting it in PBS to a working concentration of 500 nM.
-
No products found
because this supplier's products are not listed.
Caroline Passaes, et al.,
bioRxiv - Immunology 2019
Quote:
... Culture supernatants were assayed on day 7 using an SIV p27 Antigen ELISA Kit (Zeptometrix). Antiviral activity was calculated as log10 (mean p27 ng/mL in SIV-infected CD4+ T-cell cultures without CD8+ T-cells ...
-
No products found
because this supplier's products are not listed.
Concepcion Manzano, et al.,
bioRxiv - Plant Biology 2022
Quote:
... the Basic Fuchsin staining was followed by Calcofluor White (PhytoTechnology laboratories Cat no 4404-43-7) staining for 30 minutes and followed by two washing steps in Clearsee solution ...
-
No products found
because this supplier's products are not listed.
Richard J. Marsh, et al.,
bioRxiv - Cell Biology 2021
Quote:
COS-7 cells (CRL-1651, ATCC) cultured on 25-mm-diameter coverslips (CSHP-No1.5-25, Bioscience Tools) were first fixed with 37 °C pre-warmed 3% PFA (15710 ...
-
No products found
because this supplier's products are not listed.
Ekaterini Maria Lyras, et al.,
bioRxiv - Immunology 2022
Quote:
... Lyve-1 (ReliaTech 103-PA50AG; 1:500), Podoplanin (Biolegend 156202 ...
-
Cat# H7G274,
USD $125.0/pack
Ask
Hanieh Ghassabian, et al.,
bioRxiv - Microbiology 2020
Quote:
... α-UL44 mAb (Virusys Corporation, #P1202-1; 1:100); α-pp65 mAb (Virusys Corporation ...
-
No products found
because this supplier's products are not listed.
Carine Rey, et al.,
bioRxiv - Genomics 2022
Quote:
... belari bub-1 (gene mbelari.g12204) (1/10000 Covalab). Two peptides C-ALNASKEKPEEQLD-coNH2 and C-SPIVEDQDHENSTNG-coNH2 were injected in rabbits and the purified serum obtained at day 74 was used for staining.
-
No products found
because this supplier's products are not listed.
Guangyi Luo, et al.,
bioRxiv - Cell Biology 2022
Quote:
... rabbit anti-PFK-1 (1:1000, Zen-bio, China), rabbit anti-GP (1:2000 ...
-
No products found
because this supplier's products are not listed.
Kevin W. Southerland, et al.,
bioRxiv - Genomics 2023
Quote:
... anti-CD11b (Cell Sciences, MON1019-1, clone Bear-1), and anti-dystrophin (Thermo Scientific ...
-
No products found
because this supplier's products are not listed.
Katy R. McCarron, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-LC3 (1:200 WB, 1:200 IF, Nanotools; 5F10), anti-p62 (1:1,000 WB ...
-
No products found
because this supplier's products are not listed.
Tulika Singh, et al.,
bioRxiv - Immunology 2021
Quote:
... Jo-1 (Immunovision, JO1-3000) at 0.05 units/well ...
-
No products found
because this supplier's products are not listed.
J Paes de Faria, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Gapdh (HyTest, #6C5, 1:50,000), Tubulin (Sigma ...
-
No products found
because this supplier's products are not listed.
Ross D Overacker, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
Inhibition of HIV-1 integrase was assessed using an HIV-1 integrase assay kit (XpressBio Life Science Products) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Wenyang Yi, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Sheep anti VSX2 (1:400, Exalpha Biologicals), Sheep anti ONECUT2 (1:40 ...
-
No products found
because this supplier's products are not listed.
Thomas Keating, et al.,
bioRxiv - Immunology 2021
Quote:
... 1:500 mouse anti-human C1q (Quidel) or 1:100 mouse anti-human Ficolin-3 (Hycult ...
-
No products found
because this supplier's products are not listed.
Thorben Schramm, Vanessa Pahl, Hannes Link,
bioRxiv - Systems Biology 2023
Quote:
... covered with Breathe-Easy (Diversified Biotech BEM-1) adhesive membrane ...
-
No products found
because this supplier's products are not listed.
Thibault Scalvenzi, et al.,
bioRxiv - Genomics 2021
Quote:
... 20 and 5 μm filters (nylon 40 μm cell strainer from BIOLOGIX; 20 μm net ring from Pharmacia Fine chemicals ...
-
No products found
because this supplier's products are not listed.
Kazuya Matsuo, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Human frozen brain sections (5–10 μm thickness) were obtained from BioChain Institute and a part of them were treated with RNase A ...
-
No products found
because this supplier's products are not listed.
Huifang Bai, et al.,
bioRxiv - Zoology 2021
Quote:
... Records were selected systematically from 7 databases (Medline via to Pubmed ...
-
No products found
because this supplier's products are not listed.
Chloe C. Ence, et al.,
bioRxiv - Microbiology 2024
Quote:
... The cultures were incubated at 37°C with 5% CO2 and routinely checked for mycoplasma contamination using the e-Myco Plus kit from Intron Biotechnology. Human hepatocellular carcinoma cells (HepG2 ...
-
No products found
because this supplier's products are not listed.
Valerija Dobricic, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Hybridization buffers containing 5’ HEX-labeled probes were used to incubate slices in an in-situ hybridization apparatus (Boekel Slide Moat, Feasterville, Pennsylvania) at 52 °C under the condition of heat preservation and humidification ...
-
No products found
because this supplier's products are not listed.
Alberto Domingo López-Muñoz, et al.,
bioRxiv - Microbiology 2023
Quote:
... alone or in combination with purified recombinant proteins were placed in the lower chamber of a 96-well ChemoTx System plate (Neuro Probe # 101-5) in RPMI 1640 1 % FBS ...
-
No products found
because this supplier's products are not listed.
Jian Zhang, et al.,
bioRxiv - Immunology 2022
Quote:
... were cocultured with autologous memory B cells (5×104 cells) in the presence of 100 ng/ml staphylococcal enterotoxin B (SEB) (Toxin Technology, Sarasota, FL, USA) and RPMI 1640 medium supplemented with 10% FBS in 96-well U-bottom plates for 6 days ...