-
No products found
because this supplier's products are not listed.
Emanuela Torelli, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
(5Z)-5[(3,5-Difluoro-4-hydroxyphenyl)methylene]-3,5-dihydro-2-methyl-3-(2,2,2-trifluoroethyl)-4H-imidazol-4-one (DFHBI-1T) was purchased from Tocris Bio-techne ...
-
No products found
because this supplier's products are not listed.
Lucie Olejníková-Ladislavová, et al.,
bioRxiv - Animal Behavior and Cognition 2024
Quote:
The 5-HT2C antagonist 6-Chloro-2,3-dihydro-5-methyl-N-[6-[(2-methyl-3-pyridinyl)oxy]-3-pyridinyl]-1H-indole-1-carboxamide dihydrochloride (SB242084; Sigma Aldrich) at a dose of 1.0 mg/kg.
-
No products found
because this supplier's products are not listed.
Amrita Chakrabarti, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... potential was examined using 5,6-dichloro-2-[3-(5,6-dichloro-1,3-diethyl-1,3-dihydro-2H-benzimidazol-2-ylidene)-1propenyl]-1,3-diethyl-,iodide (JC-1 dye) (Life Technologies, USA) as a probe ...
-
No products found
because this supplier's products are not listed.
Prudhvi Raj Rayi, Shaya Lev, Alexander M Binshtok,
bioRxiv - Neuroscience 2023
Quote:
... The aCSF included 2,3-Dihydroxy-6-nitro-7-sulfamoyl-benzo(f)quinoxaline (NBQX, Alomone Labs) 20 μM and 2-amino-5-phosphonopentanoate (D-AP5, Abcam) 50 μM to block glutamatergic AMPA and NMDA currents ...
-
No products found
because this supplier's products are not listed.
Irene Julca, et al.,
bioRxiv - Plant Biology 2022
Quote:
... The medium was aspirated and fresh medium containing 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, premixed in 5:1 ratio, Promega) was added to the treated cells ...
-
No products found
because this supplier's products are not listed.
Krzysztof Mikołajczyk,
bioRxiv - Biochemistry 2024
Quote:
... and untransfected cells were cultured for 2 weeks in a complete medium containing 3 μM N-[(1R,2R)-1- (2,3-dihydro-1,4-benzodioxin-6-yl)-1-hydroxy-3-pyrrolidin-1-ylpropan-2-yl]nonanamide (Genz-123346) (Merck, Darmstadt, Germany), a glucosylceramide synthase inhibitor [26].
-
No products found
because this supplier's products are not listed.
Dhiraj Kumar Singh, et al.,
bioRxiv - Immunology 2020
Quote:
... Antihuman ACE-2 (R&D Systems, USA, 1:50, 2h at 37°C) was used for identification of ACE-2 ...
-
No products found
because this supplier's products are not listed.
Ashwin Narayanan, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... concentrations was assessed using reduction in WST-1 (4-[3-(4-Iodophenyl)-2-(4-nitrophenyl)-2H-5-tetrazolio]- 1,3-benzene Disulfonate) to water-soluble formazan (Roche, France). Cells were seeded in 96-well plates at 2 × 104 cells/well and treated with the different NAM concentrations at 37°C ...
-
No products found
because this supplier's products are not listed.
Teresa Neuwirth, et al.,
bioRxiv - Immunology 2024
Quote:
... Each patient was also stained with one of TotalSeq™-C0251/2/3/4 Antibody (Biolegend, Cat: 394661/3/5/7, 1:100) for sample multiplexing ...
-
No products found
because this supplier's products are not listed.
Luciana Galetto, et al.,
bioRxiv - Microbiology 2020
Quote:
Quantity One 1-D Analysis Software (Bio-Rad) was used to estimate band intensities of each sample ...
-
No products found
because this supplier's products are not listed.
Heng-Yi Chen, et al.,
bioRxiv - Immunology 2021
Quote:
... 7-Aminoactinomycin D (7-AAD; BD) was added to label the dead cells by incubating at RT for at least 5 mins and analyzed by FACS immediately ...
-
No products found
because this supplier's products are not listed.
Roza Izgilov, et al.,
bioRxiv - Cell Biology 2023
Quote:
using a fluorescent glucose analog, 2-NBDG (2-Deoxy-2-[(7-nitro-2, 1, 3-benzoxadiazol-4-yl) amino]-D-glucose) (11046, Cayman chemical). Cultured 3T3-L1 cells “starved” in a glucose-free medium at 37°C for 1 hr ...
-
No products found
because this supplier's products are not listed.
Kathryn A. Swanson, et al.,
bioRxiv - Neuroscience 2023
Quote:
... N-methyl-D-aspartate receptor 2B (NMDAR2B, rabbit, 1:1000, Cell Signaling 4270), nuclear factor kappa B (NFκB ...
-
No products found
because this supplier's products are not listed.
Aarthi Subramani, et al.,
bioRxiv - Immunology 2022
Quote:
... MSG-1 (CITED1; D-7, sc-393585, Santa Cruz Biotechnology), and STAT1 (D1K9Y ...
-
No products found
because this supplier's products are not listed.
Alan Hicks, et al.,
bioRxiv - Biophysics 2020
Quote:
... or (iv) POPG and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (POPE) at 7:3 ratio (all lipids from Avanti Polar Lipids). The protein-liposome mixtures ...
-
No products found
because this supplier's products are not listed.
Justin E. Silpe, et al.,
bioRxiv - Microbiology 2021
Quote:
... 40 μg mL−1 5-Bromo-4-Chloro-3-Indolyl-beta-D-Galactosidase (X-gal, Takara Bio), and 500 μM isopropyl beta-D-1-thiogalactopyranoside (IPTG ...
-
No products found
because this supplier's products are not listed.
Asif Ali, et al.,
bioRxiv - Cell Biology 2022
Quote:
... were grown to O.D 0.3-0.6 and incubated with non-fluorescent Halo tag ligand 7-bromo-1-heptanol (7BRO, 100μM, VWR #AAH54762) for 10 min to irreversibly mask all the pre-existing ribosomal proteins ...
-
No products found
because this supplier's products are not listed.
Clothilde Philouze, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 1 μCi of 2-Deoxy-D-[1-2-3H] glucose (PerkinElmer, Boston, MA, USA # NET328A001MC) and 10μM non-radioactive 2-DG (Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
S. P. Maher, et al.,
bioRxiv - Cell Biology 2023
Quote:
... vivax cases were infected into PHH lot BGW at day 2 post-seed (for case 1) or day 3 post-seed (for cases 2 and 3) in 384-well plates (Greiner Bio-One cat 781956) using the same methods for initiating P ...
-
No products found
because this supplier's products are not listed.
Franck Dumetz, et al.,
bioRxiv - Microbiology 2021
Quote:
... 7 μl PEG8000 and 1 μl T4 RNA ligase 2 K227Q (NEB) at 25 °C for 1 h ...
-
No products found
because this supplier's products are not listed.
Ryo Okuda, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... anti-Cytokeratin 7 (1:00; Agilent Technologies, M701829-2), anti-Cytokeratin 19 (1:100 ...
-
No products found
because this supplier's products are not listed.
Meghan Robinson, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 0.5 mM RA and 1 mM 8-bromo-cAMP (Peprotech, 2354843) were added ...
-
No products found
because this supplier's products are not listed.
Wenchao Li, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... SUMO 2/3 (Proteintech, cat. 11251-1-ap, 1:1000 for WB); Ubiquitin (Proteintech ...
-
No products found
because this supplier's products are not listed.
Rebekka Karlowitz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
No products found
because this supplier's products are not listed.
Ute Jungwirth, et al.,
bioRxiv - Cancer Biology 2020
Quote:
7 × 104 − 1 × 105 fibroblasts were embedded in rat tail collagen I (Corning; final concentration 2 mg mL−1) in 24-well plates and incubated at 37°C ...
-
No products found
because this supplier's products are not listed.
Thomas Eekhout, et al.,
bioRxiv - Plant Biology 2021
Quote:
RNA was extracted from root tips (1-2 mm) of 7-d-old seedlings using the RNEasy plant mini kit (QIAGEN), according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Juan Qin, et al.,
bioRxiv - Biochemistry 2021
Quote:
... PKAc was immobilized via standard N-hydroxysuccinimide (NHS) / 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) amine coupling on a CM5 (carboxyl methyl dextran) sensor chip (GE Healthcare). Before covalent immobilization of PKAc ...
-
No products found
because this supplier's products are not listed.
Emily J. Talbot, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 4 µM digitonin) with or without 7 µM 2’,3’-cGAMP (Invivogen). Cells were further washed in PBS and incubated in culture medium until collection ...
-
No products found
because this supplier's products are not listed.
Soma Szentkirályi-Tóth, et al.,
bioRxiv - Neuroscience 2023
Quote:
... biotin-conjugated anti-mouse IgG (Jackson ImmunoResearch Laboratories; 1:500; 2h; RT), ABC Elite reagent (Vector ...
-
No products found
because this supplier's products are not listed.
Adeline M. Fanni, et al.,
bioRxiv - Neuroscience 2021
Quote:
... the grid was stained one time for 3 minutes and three times for 1-minute each using 2% uranyl acetate (Electron Microscopy Sciences, Hatfield, PA). Excess stain was wicked away in between the steps ...
-
No products found
because this supplier's products are not listed.
Rayyan M. Gorashi, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Methyl-Lysine (MeK, 1:350, Novus Biologicals, NB600824), and acetylated lysine (AcK ...
-
No products found
because this supplier's products are not listed.
Koichiro M. Hirosawa, et al.,
bioRxiv - Cell Biology 2024
Quote:
PC-3 cells (1 × 106 cells) were transfected with 2 μg of mGFP-GPI cDNA using a 4-D nucleofector (LONZA) and cultured in two 150-mm dishes until reaching approximately 100% confluence (2 × 107 cells) ...
-
No products found
because this supplier's products are not listed.
Esther Nuebel, et al.,
bioRxiv - Cell Biology 2020
Quote:
... in a ratio of 3:2:1 using 1 mg/ml polyethylenimine (Cat#23966-1, Polysciences, Inc.). Retrovirus was harvested from the medium 48 h post-transfection ...
-
No products found
because this supplier's products are not listed.
Katerina Stepankova, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and anti-VGLUT1/2 (Synaptic Systems, #1235503, 1:800, 3 days). Goat anti-host antibodies of the respective primary antibodies conjugated with Alexa Fluor 405 ...
-
No products found
because this supplier's products are not listed.
Vítor S. Fernandes, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... samples were incubated for 2h with biotinylated anti-rabbit IgG (1:200, Vector Laboratories), washed again ...
-
No products found
because this supplier's products are not listed.
Sonja Giger, et al.,
bioRxiv - Bioengineering 2021
Quote:
... or 7-Amino-Actinomycin D (7-AAD, Beckman Coulter, B88526) was added to the cell suspensions ...
-
No products found
because this supplier's products are not listed.
Bethany C. Taylor, et al.,
bioRxiv - Systems Biology 2024
Quote:
... according to the Ovation RRBS Methyl-Seq System 1-16 protocol for the first read and the Read 2 primer (Illumina) for the second read ...
-
No products found
because this supplier's products are not listed.
Andreas Mund, et al.,
bioRxiv - Systems Biology 2021
Quote:
Leica LMD 7 cutting accuracy (Leica R&D, patent EP1276586)
-
No products found
because this supplier's products are not listed.
Mohammad S. E. Sendi, et al.,
bioRxiv - Neuroscience 2024
Quote:
... we used one adult male Sprague-Dawley rat (2– 3-month-old; 250–300 g) from Charles River Laboratories (Wilmington ...
-
No products found
because this supplier's products are not listed.
JS Cho, et al.,
bioRxiv - Pathology 2024
Quote:
... Isotype controls or fluorescence minus one (FMO) controls were used, and the live/dead marker 7-aminoactinomycin D (7-AAD, PerCP) (Miltenyi Biotec) was added to all samples 10 min before analysis (10 μl to 1 ml of cell suspension).
-
No products found
because this supplier's products are not listed.
Mai-Anh T. Vu, et al.,
bioRxiv - Neuroscience 2023
Quote:
... or Drd1-cre (Figures 1, 2, 7, Jackson labs, strain #030329) ages 11 to 24 weeks were injected with AAVs to express genetically encoded proteins for optical measurements and manipulations (see Supplementary Table 1) ...
-
No products found
because this supplier's products are not listed.
Jihae Shin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
No products found
because this supplier's products are not listed.
Bogdan B. Grigorash, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Keratin 7 (Genetex #GTX110414; 1:250), Keratin 8 (DSHB Hybridoma Product TROMA-I ...
-
No products found
because this supplier's products are not listed.
Biren M. Dave, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... differentiating cells were confluent again and split 1:3-1:4 into Step 2 differentiation medium: BrainPhys Neuronal Medium (STEMCELL Technologies, cat# 05790), 1X N2 ...
-
No products found
because this supplier's products are not listed.
Yuki Miura, et al.,
bioRxiv - Neuroscience 2024
Quote:
... regionalized neural organoids (1-3 organoids per one Eppendorf tube) were transferred into a 1.5 mL Eppendorf tube containing 200 μL of the neural medium ...
-
No products found
because this supplier's products are not listed.
Dhiraj Kumar Singh, et al.,
bioRxiv - Immunology 2020
Quote:
... or anti-SARS CoV-2 nucleocapsid (N) antibody (Sino Biologicals, USA, 1:100, 2h at 37°C). Antihuman ACE-2 (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Emily Nicole Powers, et al.,
bioRxiv - Genetics 2022
Quote:
... and either an anti-rat secondary antibody conjugated to IR Dye 680 (RRID:AB_10956590) at a 1:15,000 dilution at room temperature for 1-2h (LI-COR Biosciences). Immunoblot images were generated and quantified using the Odyssey system (LI-COR Biosciences).
-
No products found
because this supplier's products are not listed.
Zachary Beine, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The primary antibody (2-3% serum, 0.4% PBST, 1:500 Rockland 600-401-379) was applied and incubated for ninety minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Olga V. Kochenova, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... MCM6 (1:5,000; Ref.7); MCM7 (1:12,000) and RPA (1:7,000; Ref.55; MCM4 (1:2,000; (Bethyl A300-193A)) ...
-
No products found
because this supplier's products are not listed.
Eve T. Beauchemin, et al.,
bioRxiv - Microbiology 2022
Quote:
... the bacteria were first incubated in 3 wells of a 96-well plate for 1 hour in an Epoch 2 Microplate Spectrophotometer (BioTek), with optical density measured at 600 nm (OD600) ...