-
No products found
because this supplier's products are not listed.
Chan Ho Park, et al.,
bioRxiv - Plant Biology 2022
Quote:
... anti-BSL2/3 (AbFrontier; 1:2,000 dilution), anti-FLAG (Sigma ...
-
No products found
because this supplier's products are not listed.
Yin-Wei Kuo, et al.,
bioRxiv - Biophysics 2022
Quote:
... we used a 3:1 molar ratio of 2 kDa α-methoxy-ω-amino PEG: 3 kDa α-amino-ω-carboxy PEG (Rapp Polymere) in the first functionalization step ...
-
No products found
because this supplier's products are not listed.
Néstor Sampedro Vallina, et al.,
bioRxiv - Bioengineering 2023
Quote:
... (5Z)-5-[(3,5-Difluoro-4-hydroxyphenyl)methylene]-3,5-dihydro-2-methyl-3-(2,2,2-trifluoroethyl)-4H-imidazol-4-one (DFHBI-1T) was purchased from Lucerna Technologies ...
-
No products found
because this supplier's products are not listed.
Erin M. Euliano, et al.,
bioRxiv - Bioengineering 2024
Quote:
... 2 equivalents of 4-((6-Amino-2-(2-methoxyethoxy)-8-oxo-7,8-dihydro-9H-purin-9-yl)methyl)benzoic acid (Ambeed, Arlington Heights, IL), also known as 1V209 ...
-
No products found
because this supplier's products are not listed.
Yulia Kiyan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and co-transfected (using ratio pWPTS-HPSE2:pCMV-dR8.74:pMD2G = 3:2:1) into 293T cells using PerFectin transfection reagent (Genlantis) as per manufacturer ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Iliana Georgana, et al.,
bioRxiv - Microbiology 2023
Quote:
... Transfection was performed with PEI (CellnTec, 3 μL per 1 μg DNA) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Mehdi Zouiouich, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5’-AAC CGC AAT CAC ATC CAC GA-3’/5’-CAC CTC TGC CAT GAT CAC CG-3’) and the repair template (synthesized by ProteoGenix). The repair template was composed of two homology arms of 1000 bp flanking a puromycin resistance gene and mClover3 coding sequence separated by a P2A cleavage site ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Selena Y. Lin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... PG donors 3 and 4 had only plasma obtained by Lee Biosolution. In this case ...
-
No products found
because this supplier's products are not listed.
Navid Farhoudi, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 19.1 mg of 3-aminophenylboronic acid (3-APB, Frontier Scientific) was dissolved in 87 µL of dimethyl sulfoxide (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Alex M. Jaeger, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 3 µM CHIR99021 (AbMole), 1 µM PD0325901(AbMole)] ...
-
No products found
because this supplier's products are not listed.
Ha Won Lee, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... combinations of DMSO or 11 does of sotrastaurin and DMSO or 7 doses of ingenol-3-angelate were dispensed in quadruplicate using an Echo555 (Labcyte). Immunostaining and quantification of the B7-H3 protein expression level were performed as described above in the high-content imaging screening assay method section ...
-
No products found
because this supplier's products are not listed.
Mirjana Grujic, et al.,
bioRxiv - Immunology 2022
Quote:
... and 3 µl Draq7 (Biostatus, Shepshed Leicestershire ...
-
No products found
because this supplier's products are not listed.
Sheng Wu, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... (±)4-deoxyorobanchol (also named as (±)-2’-epi-5-deoxystrigol) were acquired from Chempep Inc ...
-
No products found
because this supplier's products are not listed.
Michael Tellier, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and was sequentially ligated to a 5’-adenylated 3’-adapter (5’-rApp/NNNNGATCGTCGGACTGTAGAACTCTGAAC/3ddC) with the truncated T4 RNA ligase II (Bioo Scientific) and to a 5’ adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC ...
-
No products found
because this supplier's products are not listed.
Maryann P. Platt, et al.,
bioRxiv - Microbiology 2022
Quote:
... then spotted on nitrocellulose membrane alongside serotype 4 capsular polysaccharide 3-6 μg (SSI Diagnostica cat. 76855). The membrane was then blocked with 5% BSA in TBS with 0.05% Tween-20 and probed overnight with anti-pneumococcus capsular antibody (1:500 ...
-
No products found
because this supplier's products are not listed.
Natasha M. O’Brown, et al.,
bioRxiv - Neuroscience 2021
Quote:
Larvae (7 dpf) were anesthetized with tricaine and injected with 2.3 nl of 5 nm NHS-activated gold nanoparticles (Cytodiagnostics: CGN5K-5-1, ~1.114 particles/ml in PBS) just as for the fluorescent tracer injections ...
-
No products found
because this supplier's products are not listed.
Laurens H. Lindenburg, et al.,
bioRxiv - Biochemistry 2020
Quote:
... GB1-BRC8-2 lysate was loaded on a 3 mL Ni-NTA agarose matrix (Cube Biotech), followed by the application of monomeric RAD51 lysate ...
-
No products found
because this supplier's products are not listed.
Shankar Thangamani, et al.,
bioRxiv - Microbiology 2021
Quote:
... ampicillin (69-52-3, IBI Scientific), and streptomycin (S6501 ...
-
No products found
because this supplier's products are not listed.
Sang-Chul Kim, et al.,
bioRxiv - Biochemistry 2022
Quote:
... polyclonal anti-CCA1 (R1234-3, Abiocode), and polyclonal anti-histone H3 (A01502 ...
-
No products found
because this supplier's products are not listed.
Temitayo T. Bamgbose, et al.,
bioRxiv - Immunology 2023
Quote:
... allowed to sit for 3 hours and treated with recombinant mouse IL-4 (Leinco technologies, Inc. I-207) for 4 hr ...
-
No products found
because this supplier's products are not listed.
Elena V. Kozlova, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... The active glucagon-like peptide-1 (7-36) Amide (GLP-1) assay (Cat.# 80-GLP1A-CH01, ALPCO) had an analytical sensitivity of 0.15 pM in a standard range of 0.45-152 pM and inter- and intra-assay CV of 11.6 and 9.5% ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Membranes were blocked in skim milk and incubated with anti-MASP-3 mAb 38:12-3 (Hycult Biotech, HM2216) for 1.5h at RT and HRP-conjugated rabbit anti-rat (Agilent ...
-
No products found
because this supplier's products are not listed.
M. Kyle Cromer, et al.,
bioRxiv - Genetics 2021
Quote:
... The sgRNA modifications added were the 2’-O-methyl-3’-phosphorothioate at the three terminal nucleotides of the 5’ and 3’ ends described previously38. All Cas9 protein (SpyFi S.p. Cas9 nuclease) was purchased from Aldevron, LLC (Fargo ...
-
No products found
because this supplier's products are not listed.
Rudolf O. Schlechter, et al.,
bioRxiv - Microbiology 2023
Quote:
... gas permeability of 0.6 m3 m−2 day−1 and water loss of 1 g m−2 day−1; Brooks Life Sciences, UK), and incubated at 30°C with shaking ...
-
Cat# G209,
USD $10.00/EA
Ask
Ran Lin, et al.,
bioRxiv - Molecular Biology 2024
Quote:
The eluted HIS-tagged MED1 IDR proteins and their controls (2-3 mL for each) were transferred into 15.5 mm size cellulose dialysis tube (BioDesign) and dialyzed with 1 L of dialysis buffer (50 mM Tris-HCl ...
-
No products found
because this supplier's products are not listed.
Minh Dao Ngo, et al.,
bioRxiv - Immunology 2022
Quote:
... 3 mL aminopropyl SPE columns (Biotage; Charlotte, NC). The samples were dissolved in 1 ml of hexane and transferred to the SPE column ...
-
No products found
because this supplier's products are not listed.
Marc-Joseph Antonini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and Ag/AgCl electrode (BASi, 3 M NaCl) were used as the counter and reference electrodes ...
-
No products found
because this supplier's products are not listed.
Li-Chun Cheng, et al.,
bioRxiv - Cell Biology 2023
Quote:
... rabbit anti-nesprin-3 (United States Biological Corporation), rabbit anti-myosin heavy chain (Abcam #124205) ...
-
No products found
because this supplier's products are not listed.
Evgeniia N. Bykonia, et al.,
bioRxiv - Immunology 2024
Quote:
... Plates were washed 3 times and incubated with 100 μL HRP-conjugated anti-mouse IgG secondary antibody (L20/01; HyTest; 1:25000) for 1 hour at 37°C ...
-
No products found
because this supplier's products are not listed.
Frank Hidalgo, et al.,
bioRxiv - Biophysics 2022
Quote:
... Peptides were desalted for 4 minutes on a trap column (1 mM ID x 2 cm, IDEX C-128) manually packed with POROS R2 reversed-phase resin (Thermo Scientific 1112906) ...
-
No products found
because this supplier's products are not listed.
Charles Bayly-Jones, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 5 μL of diluted C9-depleted serum (Complement Tech; diluted 1 in 5 with 1×DGHB; 2.5% (w/v) D-glucose ...
-
No products found
because this supplier's products are not listed.
Aurélien Courtois, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 1:500) and ACA (human, 15-234, Antibodies Incorporated, 1:200 (Figure 5) or 1:500 (other figures) ...
-
No products found
because this supplier's products are not listed.
Cecilia S. Blengini, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Internal control Reverse: 5’ - GTAGGTGGA AATTCTAGCATCATC C- 3’) were used at 20 pMol using FastMix French PCR beads (Bulldog Bio, #25401) following manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Christine Chevalier, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Immunostaining was performed overnight at +4°C with primary antibodies (H3K4me2 1:1000; Abcam ab32356) (H3K4me3 1:200; Diagenode C15410003) (H3K4me2 1:1000; EpiGentek A4032) (LAMP1 1:1000 ...
-
No products found
because this supplier's products are not listed.
Franziska Hentzschel, et al.,
bioRxiv - Microbiology 2023
Quote:
... the salivary gland sporozoite suspension was topped up to 1 ml with RPM and then carefully underlaid with 3 ml of 17 % Accudenz (in dH2O, Accurate Chemical & Scientific Corp., Westbury, NY, USA). Centrifugation for 20 min at 2800 rpm and at room temperature without break separated sporozoites from cell debris ...
-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A Mouse Relaxin-3 ELISA Kit was purchased from Signalway Antibody LLC (MD ...
-
No products found
because this supplier's products are not listed.
K Pilarzyk, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Overnight primary antibody incubation at 4°C was completed for the following targets: PDE11A (Aves custom PDE11#1 at 1:10,000; Fabgennix PD11A-112 at 1:500), CREB (Cell Signaling #4820 at 1:10,000 ...
-
No products found
because this supplier's products are not listed.
Jean Farup, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and Collagen 3 (Cat nb GWB-7D650E, Genway Biotec Inc, CA, USA). After incubation in primary antibodies the membranes were incubated 1 hour with HRP-conjugated secondary antibodies ...
-
No products found
because this supplier's products are not listed.
Jenna Treissman, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... 4 °C: Anti-HLA-G (1:100, 4H84, Exbio, Vestec, Czech Republic); anti-cytokeratin 7 ...
-
No products found
because this supplier's products are not listed.
Daniel Ten Martin, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... blocked in 3% BSA/ 5% normal goat serum in PBS for 1h and incubated overnight at 4°C with primary antibodies (β-III tubulin/anti-tuj-1, 1/1000, Biolegend n°801202; anti-GFP, 1/1000, Torrey Pines Biolabs n°TP-401) diluted in the blocking solution ...
-
No products found
because this supplier's products are not listed.
Hong Zheng, et al.,
bioRxiv - Microbiology 2021
Quote:
... the cells were labeled with 1:500 rabbit anti-CSP overnight at 4°C and 1:100 Red donkey anti-rabbit secondary antibody (Abbkine) for 1 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Marlys S. Fassett, et al.,
bioRxiv - Immunology 2021
Quote:
... then stimulated for 3 days in DMEM media supplemented with 10% FBS (Omega Scientific), 1% L-glutamine ...
-
No products found
because this supplier's products are not listed.
Kate M. MacDonald, et al.,
bioRxiv - Cell Biology 2022
Quote:
MCF10A cells were cultured in 1:1 mixture of F12:DMEM media supplemented with 5% horse serum (Wisent Bioproducts cat #098150), 20 ng/ml human EGF (Cedarlane Labs cat #AF-100-15) ...
-
No products found
because this supplier's products are not listed.
Trevor M Nolan, et al.,
bioRxiv - Plant Biology 2022
Quote:
... plated on 1/2 Linsmaier and Skoog (LSP03-1LT, Caisson Labs; pH 5.7), 1% sucrose media ...
-
No products found
because this supplier's products are not listed.
Yuqing Wang, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... female Lewis rats received a subcutaneous injection of 200□μl of a 1:1 emulsion of 2□mg/ml porcine type II collagen (20031, Chondrex, Redmond, WA) with incomplete Freund’s adjuvant at the base of the tail ...
-
No products found
because this supplier's products are not listed.
Yuki Sato, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... The embryos were embedded in 3% agarose/PBS and subjected to vibratome sectioning into 140-μm-thick sections at 5100 mz (Campden Instruments). The slices were pre-blocked with 5% fetal bovine serum (FBS ...
-
No products found
because this supplier's products are not listed.
Jiaojiao Xu, et al.,
bioRxiv - Physiology 2022
Quote:
Plasma renin activity was measured in 3-month old Olfr558 WT and KO mice with a modified angiotensin I measurement kit (S-1188, Peninsula Laboratories). Plasma was collected from male and female Olfr558 WT and KO mice treated with 0.49% NaCl diet (Cat ...
-
No products found
because this supplier's products are not listed.
Antonella Scaglione, et al.,
bioRxiv - Immunology 2021
Quote:
... COVID-19 convalescent plasma was diluted (1:10) and incubated with recombinant SARS-CoV-2 full-length Spike (BPS Bioscience) for 1 h at 37 °C prior to adding to an hACE2 pre-coated ELISA plates ...