-
No products found
because this supplier's products are not listed.
Mario Figueroa, et al.,
bioRxiv - Physiology 2023
Quote:
... plates were held under Static conditions or subjected to 12% biaxial cyclic Stretch for 3 hours or 12 hours utilizing the Flexcell culture system (Flexcell International Corporation ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Membranes were blocked in skim milk and incubated with anti-MASP-3 mAb 38:12-3 (Hycult Biotech, HM2216) for 1.5h at RT and HRP-conjugated rabbit anti-rat (Agilent ...
-
No products found
because this supplier's products are not listed.
Ha Won Lee, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... combinations of DMSO or 11 does of sotrastaurin and DMSO or 7 doses of ingenol-3-angelate were dispensed in quadruplicate using an Echo555 (Labcyte). Immunostaining and quantification of the B7-H3 protein expression level were performed as described above in the high-content imaging screening assay method section ...
-
Superoxide dismutase (SOD) is an antioxidant enzyme involved in the defense system against...
Cat# PBCA1002,
Inquiry
Ask
Shuangfen Tao, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... We purchased Target sequences for Bcl-2 miRNA 3’-UTR clone and the one with a site mutation at miR-383-binding site from Creative Biogene (Shirley, NY, USA). We seeded MiR-383-modified cells of GC in 24-well plates ...
-
No products found
because this supplier's products are not listed.
Courtney L. Finch, et al.,
bioRxiv - Microbiology 2020
Quote:
... The Catalyst One analyzer (IDEXX Laboratories) was used for biochemical analyses of serum samples ...
-
No products found
because this supplier's products are not listed.
Joseph M. Varberg, et al.,
bioRxiv - Cell Biology 2020
Quote:
... pombe cDNA library (AS One International, Inc.) using KOD Hot Start DNA polymerase (Millipore Sigma) ...
-
No products found
because this supplier's products are not listed.
Pranjal Biswas, Dennis J. Stuehr,
bioRxiv - Cell Biology 2022
Quote:
NOC-18 (Dojindo Molecular Technologies # N379-12) was freshly dissolved in cell culture grade sterile PBS at a stock concentration of 10 mM and added to phenol red free cell culture medium containing 10% serum and L-Trp at 2 mM final concentration ...
-
No products found
because this supplier's products are not listed.
Yuka Sakata, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Antigens were retrieved using HistoVT One (Nacalai USA) for 20 min at 70 °C and washed in PBS for 10 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Bo Liang, et al.,
bioRxiv - Microbiology 2020
Quote:
... KCl (CAS 7447-40-7) (Spectrum Chemicals, New Brunswick, NJ) and water ...
-
No products found
because this supplier's products are not listed.
Masaru Nakao, et al.,
bioRxiv - Cell Biology 2023
Quote:
... operated with an LDI-7 Laser Diode Illuminator (Chroma Technologies Japan ...
-
No products found
because this supplier's products are not listed.
Kathrin Frey, et al.,
bioRxiv - Systems Biology 2023
Quote:
... All-in-one ready-to-use (Cell Applications Inc, 211A-500) without antibiotics.
-
Lenti/Retro virus
Cat# KC30796,
ViroMag RL 200µl + Magnetic Plate MF96000, USD $654.00/KIT
Ask
Ariel Caviedes, et al.,
bioRxiv - Neuroscience 2020
Quote:
Neuronal cultures of 7 DIV were transfected using magnetic nanoparticles (NeuroMag, Oz Biosciences). Briefly ...
-
No products found
because this supplier's products are not listed.
Daniel A. Kramer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... All measurements were performed on a Horiba Scientific FluoroMax spectrofluorometer in 3 mm quartz cuvettes (Starna Cells, Inc. Cat # 3-3.45-Q-3). Normalized peak fluorescent values were calculated by dividing the fluorescence value of the peak by the concentration of that sample.
-
3',3'-Cyclic GAMP ( cGAMP ) ELISA / Assay Kit
Cat# K073-H1,
1.0 ea, USD $465.0
Ask
Abraham Shim, et al.,
bioRxiv - Genetics 2024
Quote:
... 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays #K067-H5) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Michel Thépaut, et al.,
bioRxiv - Immunology 2020
Quote:
Baby hamster kidney cells (BHK-21, 12-14-17 MAW, Kerafast, Boston, MA) and African Green Monkey Cell Line (VeroE6 ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Jolet Y. Mimpen, et al.,
bioRxiv - Immunology 2021
Quote:
... Primers (Supplementary Table 3) were purchased from Primerdesign Ltd (Primerdesign Ltd ...
-
No products found
because this supplier's products are not listed.
Laura Maria Florez, et al.,
bioRxiv - Immunology 2023
Quote:
... between passages 3 and 7 in complete mouse endothelial cell medium (from Cell Biologics, Euromedex) composed of mouse endothelial cell medium with the addition of endothelial cell medium supplement kit (from Cell Biologics ...
-
No products found
because this supplier's products are not listed.
Charlotte Repton, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Ovaries from 3-day matured flies were dissected one at a time in Halocarbon oil (700; Halocarbon) on a cover slip ...
-
No products found
because this supplier's products are not listed.
Néstor Sampedro Vallina, et al.,
bioRxiv - Bioengineering 2023
Quote:
... (5Z)-5-[(3,5-Difluoro-4-hydroxyphenyl)methylene]-3,5-dihydro-2-methyl-3-(2,2,2-trifluoroethyl)-4H-imidazol-4-one (DFHBI-1T) was purchased from Lucerna Technologies ...
-
No products found
because this supplier's products are not listed.
Christin Herrmann, et al.,
bioRxiv - Microbiology 2020
Quote:
... with 0.15% v/v TFA and separated into either 3 high-pH fractions (enriched ubiquitinated peptides) or 7 high-pH fractions (global proteome) over C18 columns (The Nest Group, MicroSpin column C18 silica ...
-
No products found
because this supplier's products are not listed.
Yuliya Voskobiynyk, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and CACNB4 N10/7 (Antibodies Incorporated), BIN1 H-100 (Santa Cruz sc-30099) ...
-
No products found
because this supplier's products are not listed.
C. Fung, et al.,
bioRxiv - Neuroscience 2021
Quote:
... GLP-1 (7-36)-amide (Phoenix Pharmaceuticals), CCK-8 (PolyPeptides Laboratories) ...
-
No products found
because this supplier's products are not listed.
Hajar Mikaeili, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 7-10 µm thick) and Human Prostate Frozen Sections (HF-408, 7-10 µm thick) were obtained commercially from Zyagen (www.zyagen.com) via AMS Biotechnology (https://www.amsbio.com ...
-
No products found
because this supplier's products are not listed.
Simona Pellecchia, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... matched with the ones provided by Cellecta’s whitelist were used ...
-
No products found
because this supplier's products are not listed.
Nayab Fatima, et al.,
bioRxiv - Neuroscience 2020
Quote:
Primary human astrocytes (passage 2-7) obtained from ScienCell were cultured in astrocyte medium (ScienCell ...
-
No products found
because this supplier's products are not listed.
Pragya D Yadav, et al.,
bioRxiv - Microbiology 2021
Quote:
... One step luciferase assay kit from BPS Bioscience was used for detection ...
-
No products found
because this supplier's products are not listed.
Dhananjay M. Nawandar, et al.,
bioRxiv - Microbiology 2022
Quote:
... One or two drops of 0.5% proparacaine (McKesson Corp.) were applied to the eye ...
-
No products found
because this supplier's products are not listed.
Andre Machado Xavier, et al.,
bioRxiv - Neuroscience 2022
Quote:
... using a 7 ml dounce tissue grinder (DWK Life Sciences, 357542) as performed in Gosselin et al ...
-
No products found
because this supplier's products are not listed.
Hunter K. Walt, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Bed bug colonies were kept in plastic jars containing corrugated cardboard harborages at 28 +/- 1° C and 60-70% relative humidity with a photoperiod of 12:12 hours (L:D) and fed once per week using mechanically defibrinated rabbit blood (Hemostat Laboratories, Dixon, CA) once per week using a Hemotek membrane feeding system (Hemotek LTD ...
-
No products found
because this supplier's products are not listed.
Francesco Girardi, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 30 ul of CTX (12 mM in saline, Latoxan) was injected into hindlimb TA muscles to induce injury ...
-
No products found
because this supplier's products are not listed.
Joanna Domagala, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... MCF-7 cells were seeded on 16-well E-Plates (ACEA Biosciences) at a cell density 3 × 104 per well in 150 μl of the DMEM medium and monitored for 24h ...
-
No products found
because this supplier's products are not listed.
Qi Qu, et al.,
bioRxiv - Physiology 2023
Quote:
... TAG(16:0)3-d5 and TAG(18:0)3-d5 (CDN isotopes), while DAGs d5-DAG17:0/17:0 and d5-DAG18:1/18:1 (Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Snježana Kodba, et al.,
bioRxiv - Cell Biology 2024
Quote:
... one well of an 8-well Ibidi chambers (IBI Scientific #80807) was coated with 10 mg/mL Laminin (Sigma ...
-
No products found
because this supplier's products are not listed.
Adriana Blazeski, et al.,
bioRxiv - Bioengineering 2023
Quote:
... at passage 7 were maintained in FibroLife S2 Fibroblast Medium (Lifeline Cell Technology) and cultured until 50-70% confluency prior to use in MVNs ...
-
No products found
because this supplier's products are not listed.
Jason K. H. Lai, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... 12 kPa and 25 kPa collagen-coated Softslips (Matrigen, CA, USA), as well as glass cover slips in individual wells of a 24-well plate ...
-
No products found
because this supplier's products are not listed.
Daniel Centeno, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... GFP-expressing cells were seeded in a 12-well plate (CELLTREAT) and incubated overnight ...
-
No products found
because this supplier's products are not listed.
Alvina I. Khamidullina, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Primers CDKN1B-forv 5’-attagctagcATGTCAAACGTGCGAGTGTCTAA-3’ and CDKN1B-rev 5’-taatggatccTTACGTTTGACGTCTTCTGAGGC-3’ (Evrogen, Moscow, Russia) containing NheI and BamHI restriction sites were used for amplification ...
-
No products found
because this supplier's products are not listed.
Theresa Schmid, et al.,
bioRxiv - Immunology 2023
Quote:
... while the cognate 12-mer was generated by custom peptide synthesis (Biomatik). Both were resuspended at a stock concentration of 10 mg mL-1 in 10% DMSO and stored at -80°C ...
-
No products found
because this supplier's products are not listed.
Elia Obis, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3-ketoacyl-CoA thiolase (MyBioSource MBS1492126) used at a dilution of 1/100 ...
-
No products found
because this supplier's products are not listed.
Julius Brandenburg, et al.,
bioRxiv - Immunology 2020
Quote:
... isolated cells were incubated for 7 days in Teflon bags (VueLife 72C; Cellgenix, Freiburg, Germany) in VLE RPMI 1640 (Biochrome ...
-
No products found
because this supplier's products are not listed.
Thomas HB FitzGerald, et al.,
bioRxiv - Neuroscience 2019
Quote:
... which probabilistically generate one of two possible observations ot ∈ {1,2} (Costa et al., 2015; FitzGerald et al. ...
-
No products found
because this supplier's products are not listed.
Elena V. Kozlova, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... The active glucagon-like peptide-1 (7-36) Amide (GLP-1) assay (Cat.# 80-GLP1A-CH01, ALPCO) had an analytical sensitivity of 0.15 pM in a standard range of 0.45-152 pM and inter- and intra-assay CV of 11.6 and 9.5% ...
-
No products found
because this supplier's products are not listed.
Xiangyu Zhou, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... succinyl-Leu-Leu-Val-Tyr-7-amino-4-methylcoumarin (Suc-LLVY-MCA; Peptide Institute, Cat#3120-v) in 100 mM Tris-HCl (pH 8.0 ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 8: (S)-2-Amino-6-((2-(3-methyl-3H-diazirin-3-yl)ethoxy)carbonylamino)hexanoic acid (PhK, Iris Biotech GmBH); and 9 ...
-
No products found
because this supplier's products are not listed.
William L. Brown, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... washed 3 times with CitrisolvTM (Decon Labs, #1601) or xylene for 5-min/each ...
-
No products found
because this supplier's products are not listed.
Adam T. Hilterbrand, et al.,
bioRxiv - Microbiology 2021
Quote:
1×105 cells (C10 and CHO-HVEM) were seeded onto 12 mm glass coverslips (Chemglass) in 24 well plates ...
-
No products found
because this supplier's products are not listed.
John Heath, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... at 1:3 ratio and spread over the CometSlide (Trevigen). Slides were dried at room temperature for 2 minutes and immersed into neutral lysis buffer overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Francisco Dominguez, et al.,
bioRxiv - Microbiology 2021
Quote:
... It was cloned into pE-SUMOpro-3 plasmid (LifeSensors Inc.) between Nco I and Xho I restriction sites ...
-
No products found
because this supplier's products are not listed.
Duy Lan Huong Bui, et al.,
bioRxiv - Cell Biology 2023
Quote:
... using a 1:3 mixture of LipoD293 (SignaGen Laboratories SL100668). 48 hours later ...