-
No products found
because this supplier's products are not listed.
Steven A. Erickson, et al.,
bioRxiv - Immunology 2021
Quote:
... 5-7 IU of PMSG (Millipore #367222/BioVendor #RP1782721000) was injected (IP ...
-
No products found
because this supplier's products are not listed.
Kim S. Friedmann, et al.,
bioRxiv - Immunology 2020
Quote:
... APC-labelled anti-MART-1 (ELAGIGILTV) dextramers (Immudex, 1:5), APC-labelled A*0201 dextramer negative control (Immudex ...
-
No products found
because this supplier's products are not listed.
Paule Dagenais, et al.,
bioRxiv - Biophysics 2021
Quote:
... excisions of rays were conducted using a micro dissecting knife (RS-6220, dean knife 5” 1 mm x 7 mm blade curved, Roboz Surgical Instrument Co. ...
-
No products found
because this supplier's products are not listed.
Telmo A. Catarino, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... or LPS (1:100, WN1 222-5, Hycult Biotech) at 4 ° C ...
-
No products found
because this supplier's products are not listed.
Dipsikha Biswas, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 0.8 ng/uL in H2O containing sodium-2-Keto-3-methyl-d3-butyrate-3,4,4,4d4 (KIVd7; CDN Isotopes), 120 µl of 6M perchloric acid (VWR ...
-
No products found
because this supplier's products are not listed.
Nauman Malik, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5% bovine serum albumin and 0.05% sodium-Azide) containing either MOAB-2 (1:1000, Cat# M-1586-100, Biosensis) for the detection of Aβ or AT-8 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Stephan Tetenborg, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 1 µg of DNA were transfected using 5 µl Geneporter2 (Genlantis) or 1.5 µl Lipofectamine 2000 (Thermo Fisher).
-
No products found
because this supplier's products are not listed.
Leonid Andronov, et al.,
bioRxiv - Microbiology 2023
Quote:
... mouse monoclonal anti-dsRNA (SCICONS, 10010200, 1:200, 5 µg/mL), rabbit polyclonal anti-RdRp/nsp12 (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Shannan P. McClain, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5 minutes later at 2 µM elenterazine (Prolume Ltd) was added and luminescence (490 to 410 nm ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Allison R. Fusilier, et al.,
bioRxiv - Neuroscience 2021
Quote:
... BMAL1 (1:1000 in 5% BSA and TBST, Signalway Antibody, LLC, #21415,), GSK3β (3D10 ...
-
No products found
because this supplier's products are not listed.
Shariq S. Ansari, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-AC5/6 (FabGennix, 1:75), anti-AC3 (Proteintech ...
-
No products found
because this supplier's products are not listed.
Mohammed Mohasin, et al.,
bioRxiv - Immunology 2021
Quote:
... Nuclei were stained with 5 µM Draq5 (Biostatus Ltd. 1:1000 in PBS). Coverslips were mounted onto microscope slides with a glycerol free poly-(vinyl alcohol ...
-
Cat# 58610-63-2,
Inquire
Ask
Alexandra Gros, et al.,
bioRxiv - Neuroscience 2023
Quote:
... These rats also received one intraperitoneal injection of 5-Bromo-2’-deoxyuridine (BrdU, 200 mg/kg in 0.9% NaCl, BOC Sciences 59-14-3) 24h before sacrifice to study adult newborn cell proliferation after several days of simulated microgravity exposure and to reduce the number of animals used for this study.
-
No products found
because this supplier's products are not listed.
Geoffrey L. Rogers, et al.,
bioRxiv - Immunology 2023
Quote:
... Plates were coated with 5 µg/mL HIV-1 JR-CSF gp120 (Immune Technology) in coating buffer ...
-
No products found
because this supplier's products are not listed.
Jérôme Cattin-Ortolá, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5% FBS (RMBIO), and 1X Pen/Strep (GIBCO ...
-
No products found
because this supplier's products are not listed.
Ekaterina Kropocheva, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 5% glycerol) supplemented with 1 mM of PMSF and disrupted using Cell Disruptor CF (Constant Systems). The lysate was cleared by centrifugation ...
-
No products found
because this supplier's products are not listed.
Yijiun Zhang, Joachim Seemann,
bioRxiv - Cell Biology 2023
Quote:
... 5 µl rabbit polyclonal anti- GM130 serum (Wei and Seemann, 2009b) or 1 µg rabbit IgG (ImmunoReagents) as control ...
-
No products found
because this supplier's products are not listed.
Alexa M. Schmitz, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... was cultured in yeast peptone mannitol (YPM; 5 g L-1 yeast extract (C7341, Hardy Diagnostics, Santa Maria, CA), 3 g L−1 peptone (211677 ...
-
No products found
because this supplier's products are not listed.
Callie P. Wigington, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5-6 mg of lysate was used for pull-downs with 30 μl of GFP-Trap magnetic beads (Bulldog Bio. Inc.) in binding buffer (50 mM Tris-HCl pH 7.5 ...
-
2'3'-cyclic GAMP ( cGAMP ) FRET Detection / assay Kit
Cat# K081-F5,
1.0 ea, USD $1560.0
Ask
Abraham Shim, et al.,
bioRxiv - Genetics 2024
Quote:
... 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays #K067-H5) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
RAG da Silva, et al.,
bioRxiv - Microbiology 2019
Quote:
... ET-5 purchased from LGC Standards and L91543 serogroup C:2aP1.2 ...
-
No products found
because this supplier's products are not listed.
Prashant P. Damke, et al.,
bioRxiv - Microbiology 2022
Quote:
... and 5% FBS (Cell Biologics H6621) in collagen-coated cell culture flasks at 5% CO2 and 37°C ...
-
No products found
because this supplier's products are not listed.
Raissa R. Christoff, et al.,
bioRxiv - Neuroscience 2021
Quote:
... aliquots were centrifugated and washed trice in 0.1M PBS (1,500RPM, 5 min each) and then incubated with 1:200 mouse anti-SATB21:200 (GenWay 20-372-60065) in blocking solution (2μl BSA 5% ...
-
No products found
because this supplier's products are not listed.
Shijie Cao, et al.,
bioRxiv - Bioengineering 2023
Quote:
... CAIA was induced by passive immunization with an anti-collagen antibody cocktail (1 mg per mice by i.p. injections, Arthrogen-CIA® 5-Clone Cocktail Kit, Chondrex, Inc.) (on day 0 ...
-
No products found
because this supplier's products are not listed.
Chetan Kumar Arya, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and Wizard Classic 1 and 2 (Rigaku Japan). Crystals of DMFase were obtained by mixing 200 nl of protein in buffer A with equal volumes of precipitant ...
-
No products found
because this supplier's products are not listed.
Rahul Bhattacharjee, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Haploid integrants were then isolated based on resistance to 5-fluorourotic acid (5-FOA) (United States Biological; F5050) and integration of the cdc15 mutations was verified by growth on selective media followed by PCR and DNA sequencing ...
-
No products found
because this supplier's products are not listed.
Isabella M. Fuentes, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Mice were singly confined to a sheet of filter paper (11 × 5 × 3.5 cm) for 1 hour using an inverted Micro-Isolator cage bottom (Lab Products, Seaford, DE). At the end of the testing period ...
-
No products found
because this supplier's products are not listed.
Javier Emperador-Melero, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 5% Fetal Select bovine serum (Atlas Biologicals), 2% B-27 supplement ...
-
No products found
because this supplier's products are not listed.
Karen T. Elvers, et al.,
bioRxiv - Biochemistry 2021
Quote:
... and 5 μg of BirA (Avidity, LLC), to a final volume of 500 μL buffer [20 mM Tris.HCl pH 7.8 ...
-
No products found
because this supplier's products are not listed.
Naoki Hayashi, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... tetracycline hydrochloride (IBI Scientific, 5 μg/mL), Polymyxin B sulfate (Merck Millipore ...
-
No products found
because this supplier's products are not listed.
G Maddaloni, YJ Chang, RA Senft, SM Dymecki,
bioRxiv - Neuroscience 2023
Quote:
... 3 steps (2 steps for Fluorogold [Fluorochrome] injections) of 5 nL each (1 min apart ...
-
No products found
because this supplier's products are not listed.
Terje Wimberger, et al.,
bioRxiv - Bioengineering 2019
Quote:
... Adaptors to the flow system (NanoPort Std 6-32 Coned 1/32, IDEX, USA) were fixed to in- and outlets ...
-
No products found
because this supplier's products are not listed.
Rebecca O’Cleirigh, Roslyn Gibbs,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... containing 5% (v/v) FCS and incubated overnight in a humidified atmosphere at 37°C and 5% CO2 (Nuaire, DH Autoflow). After 24 hours 1.5mL of the media was removed and media with herb extract or media only control was added ...
-
No products found
because this supplier's products are not listed.
Julia Ledderose, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Time-pregnant female mice were injected intraperitoneally with 50 mg/kg BrdU (5-bromo-2’-deoxyuridine, BrdU; Accurate Chemical & Scientific Corporation) at E11.5 ...
-
No products found
because this supplier's products are not listed.
Yan Zhang, et al.,
bioRxiv - Neuroscience 2021
Quote:
... at ∼1×105 cells per well in 100 µL of a 1:2 mixture of NbActiv4 (BrainBits) and plating medium (28 mM glucose ...
-
No products found
because this supplier's products are not listed.
Yu-Heng Tseng, et al.,
bioRxiv - Plant Biology 2022
Quote:
... Membranes were saturated with 5% milk powder in PBS with 0,05% Tween-20 (PBS-T) followed by immunostaining with anti-GFP antibodies (Torrey Pines Biolabs, 1:5000 in PBS-T) and secondary goat-anti-rabbit antibodies coupled to alkaline phosphatase (Applied Biosystems ...
-
No products found
because this supplier's products are not listed.
Maria Kuzikov, et al.,
bioRxiv - Molecular Biology 2023
Quote:
5 µl/ 100 nM of USP7/USP14 (BPS bioscience, #80364) were added to assay plates containing the compounds ...
-
No products found
because this supplier's products are not listed.
Reihaneh Bashiri, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... for 5 min at 120 V (Bio-Rad Mini-PROTEAN®). The gel was stained following the protocol of Bio-Safe Coomassie Brilliant Blue G-250 and was destained overnight (details in Supplementary file 2) ...
-
No products found
because this supplier's products are not listed.
Bader M. Jarai, Catherine A. Fromen,
bioRxiv - Bioengineering 2021
Quote:
BMMs in 6-well plates (1×106 cells/well) were detached using Accutase® (Innovative Cell Technologies, Inc.) and washed twice with PBS supplemented with 2% FBS ...
-
No products found
because this supplier's products are not listed.
Arun Sharma, et al.,
bioRxiv - Cell Biology 2020
Quote:
... SARS-CoV-2 double stranded RNA (1:100, J2 clone; Absolute Antibody Inc.); cleaved caspase-3 (1:200 ...
-
No products found
because this supplier's products are not listed.
Hsiao-Jou Cortina Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... filtered and incubated with 5 mL PureCube Ni-NTA agarose (Cube Biotech) for 1 h at 21°C ...
-
No products found
because this supplier's products are not listed.
Alexandre Champroux, et al.,
bioRxiv - Genetics 2023
Quote:
... each 35.5 cm long and 5 cm wide (Campden Instruments Ltd, Lafayette, IN). General mouse activity was analyzed for 5 min ...
-
No products found
because this supplier's products are not listed.
Takuya Yoshida, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and with varied length varied (3-6 mm depending on the place) (RWD Life science Inc, US and Doric Lenses, Canada). The fiber probe was secured by adhesion bond (Loctite 454 ...
-
No products found
because this supplier's products are not listed.
Balakumaran Chandrasekar, et al.,
bioRxiv - Microbiology 2021
Quote:
... The freeze-dried material was dialyzed against 3 liters of Milli-Q water at 4°C using a 1 kDa cut-off dialysis tubing (Repligen Spectra/Por 6 Pre-Wetted Regenerated Cellulose ...
-
No products found
because this supplier's products are not listed.
Audrey Tze Ting Khoo, et al.,
bioRxiv - Neuroscience 2020
Quote:
... the same solution containing the primary antibody overnight at 4°C (anti-tRFP, 1:1000, Evrogen; anti-GABA, 1:2000, MilliporeSigma anti-parvalbumin, 1:2000, Abcam; anti-somatostatin, 1:1000, Peninsula Laboratories) (iii ...
-
No products found
because this supplier's products are not listed.
Sergej Franz, et al.,
bioRxiv - Microbiology 2020
Quote:
... AP1153a, Abcepta, 1:500), rabbit anti-CHIKV antiserum (IBT Bioservices, 1:10,000) or mouse anti-p24 (ExBio, 1:1000). Secondary antibodies conjugated to Alexa680/800 fluorescent dyes were used for detection and quantification by Odyssey Infrared Imaging System (LI-COR Biosciences).
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Sei Motouchi, et al.,
bioRxiv - Biochemistry 2023
Quote:
... was incubated in 5 mM Tris-HCl buffer (pH 7.5) containing each substrate (1% glucomannan, Neogen, MI, USA; 1% polygalacturonic acid, Neogen; 1% carboxymethyl cellulose ...
-
No products found
because this supplier's products are not listed.
Elana Bryan, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Gels were washed three times with deionized water for 5 min each before staining with InstantBlue (Expedeon) for 1 h ...