-
7-Amino Actinomycin D is a small molecule which can act as a Fluorescent DNA probe. It is...
Cat# abx282463-5MG,
5 mg USD $594.5
Ask
Mark Møiniche, et al.,
bioRxiv - Bioengineering 2024
Quote:
... followed by incubation with a primary rabbit anti-Mal d 3 polyclonal antibody (Catalog #abx300086, Abbexa) for 1 hour ...
-
No products found
because this supplier's products are not listed.
Charles B. Reilly, et al.,
bioRxiv - Microbiology 2024
Quote:
... B.1.617.2 (delta) and B.1.1.28 (gamma)) were obtained from Cellecta Inc and B.1.529 (omicron ...
-
No products found
because this supplier's products are not listed.
K. Saini, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... (3Helix, Inc., B-CHP) and fluorescent Streptavidin conjugate Alexa-594 (Thermofisher -S11227 ...
-
No products found
because this supplier's products are not listed.
Nobuyuki Oguri, et al.,
bioRxiv - Pathology 2023
Quote:
... and 50 mM HEPES-NaCl (pH 7.4) with 3 mM H-D-isoleucyl-L-prolyl-L-arginine-p-nitroaniline dihydrochloride (Chromogenix S-2288, Diapharma).
-
No products found
because this supplier's products are not listed.
Md Gulam Musawwir Khan, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Cell survival was measured using the WST-8 (water-soluble Tetrazolium-8: 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)- 5- (2,4-disulfophenyl)-2H-tetrazolium) assay kit (CCK-8; Dojindo Molecular Technologies, #CK04) following manufacturer’s instructions ...
-
Superoxide dismutase (SOD) is an antioxidant enzyme involved in the defense system against...
Cat# PBCA1002,
Inquiry
Ask
Konner Cool, et al.,
bioRxiv - Microbiology 2021
Quote:
... VA) and Vero E6 cells stably expressing transmembrane serine protease 2 (Vero-E6/TMPRSS2)7 were obtained from Creative Biogene (Shirley, NY) via Kyeong-Ok Chang at KSU and used for virus propagation and titration ...
-
No products found
because this supplier's products are not listed.
Holly C. Ford, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Cells were harvested 2-3 hours later and lysed using a cell disrupter (Constant Systems Ltd.). Proteins were purified from inclusion bodies using Nickel affinity chromatography on prepacked HisTrap FF columns (Cytiva ...
-
No products found
because this supplier's products are not listed.
Elisa Matas-Rico, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Granzyme B-PE (1:200, clone GB11, Sanquin Amsterdam). To detect cytokine production ...
-
No products found
because this supplier's products are not listed.
Ritesh Tandon, et al.,
bioRxiv - Microbiology 2020
Quote:
... chondroitin sulfate D (CS-D, Mw = 20 kDa) from whale cartilage (Seikagaku, Tokyo, Japan) and chondroitin sulfate E (CS-E ...
-
No products found
because this supplier's products are not listed.
Barbara J. Mann, et al.,
bioRxiv - Microbiology 2022
Quote:
... primed 7-day Alzet® osmotic pumps (Durect, Cuperton, CA) containing saline or drug were implanted subcutaneously (McCray et al. ...
-
No products found
because this supplier's products are not listed.
Masaru Nakao, et al.,
bioRxiv - Cell Biology 2023
Quote:
... operated with an LDI-7 Laser Diode Illuminator (Chroma Technologies Japan ...
-
No products found
because this supplier's products are not listed.
Büsranur Geckin, et al.,
bioRxiv - Immunology 2022
Quote:
... a 7 μM stock was used (NextFlex DNA barcodes, Bioo Scientific). First ...
-
No products found
because this supplier's products are not listed.
Alex M. Jaeger, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 3 µM CHIR99021 (AbMole), 1 µM PD0325901(AbMole)] ...
-
No products found
because this supplier's products are not listed.
N Vishnu, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... Insulin secretion was measured with a human insulin ELISA (Mercodia A/B, Sweden) according to manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Shankar Thangamani, et al.,
bioRxiv - Microbiology 2021
Quote:
... ampicillin (69-52-3, IBI Scientific), and streptomycin (S6501 ...
-
No products found
because this supplier's products are not listed.
Kevin J Pridham, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... containing 3% fetal bovine serum (Peak Serum, Inc.), 10 X G-5 Supplement (Gibco) ...
-
No products found
because this supplier's products are not listed.
Chiho Watanabe, et al.,
bioRxiv - Biophysics 2022
Quote:
... and rhodamine-B-labeled PEG with a molar mass of 5 kg/mol (RB-PEG5k; Nanocs, MA, USA). Additionally ...
-
No products found
because this supplier's products are not listed.
Barun Mahata, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Next each of 3 100ul aliquots (∼1/3 of each 24 well) of cells were processed for H3K4me3 antibody (Epicypher, #13-0041), H3K27ac antibody (Epicypher ...
-
No products found
because this supplier's products are not listed.
S.M. Hetzer, et al.,
bioRxiv - Neuroscience 2023
Quote:
Fluoro-Jade B (FJ-B; Histo-Chem, Jackson, AR; CAT# 1FJB), a marker for degenerating neurons and axons,(Schmued and Hopkins ...
-
No products found
because this supplier's products are not listed.
Yu Ning, et al.,
bioRxiv - Microbiology 2020
Quote:
... Itraconazole (ITZ) and amphotericin B (Amp B) were purchased from LKT Laboratories, Inc ...
-
No products found
because this supplier's products are not listed.
Christin Herrmann, et al.,
bioRxiv - Microbiology 2020
Quote:
... with 0.15% v/v TFA and separated into either 3 high-pH fractions (enriched ubiquitinated peptides) or 7 high-pH fractions (global proteome) over C18 columns (The Nest Group, MicroSpin column C18 silica ...
-
No products found
because this supplier's products are not listed.
Esther Cañibano, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 2 ug total RNA extracted from 7 day old seedlings with the Favorprep Plant Total RNA Purification Mini kit (Favorgen) was used for cDNAs synthesis with using the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems ...
-
No products found
because this supplier's products are not listed.
Yuliya Voskobiynyk, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and CACNB4 N10/7 (Antibodies Incorporated), BIN1 H-100 (Santa Cruz sc-30099) ...
-
No products found
because this supplier's products are not listed.
Yin-Wei Kuo, et al.,
bioRxiv - Biophysics 2022
Quote:
... we used a 3:1 molar ratio of 2 kDa α-methoxy-ω-amino PEG: 3 kDa α-amino-ω-carboxy PEG (Rapp Polymere) in the first functionalization step ...
-
No products found
because this supplier's products are not listed.
Yukari Nagatoshi, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Samples of 1 to 2 mg were weighed using a microbalance (BM-22; A&D Company Limited, Japan) and analyzed for total N content using an NC analyzer (Series II CHNS/O Analyzer 2400 ...
-
No products found
because this supplier's products are not listed.
Huifang Bai, et al.,
bioRxiv - Zoology 2021
Quote:
... Records were selected systematically from 7 databases (Medline via to Pubmed ...
-
No products found
because this supplier's products are not listed.
Emily A Wheeler, et al.,
bioRxiv - Immunology 2023
Quote:
... and Factor B were purchased from Complement Technologies.
-
No products found
because this supplier's products are not listed.
Yulia Kiyan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and co-transfected (using ratio pWPTS-HPSE2:pCMV-dR8.74:pMD2G = 3:2:1) into 293T cells using PerFectin transfection reagent (Genlantis) as per manufacturer ...
-
No products found
because this supplier's products are not listed.
Ryoji Amamoto, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... chicken B-galactosidase (1:3000, Aves Labs, cat. #BGL1010), goat B-galactosidase (1:3000 ...
-
No products found
because this supplier's products are not listed.
Sarah A. Ware, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Pools B-E were purchased (BioIVT, Hicksville, NY, USA). Each lot was aliquoted and stored at -80 °C.
-
Cat# 24964-09-8,
Inquire
Ask
Micah Y. Belew, et al.,
bioRxiv - Neuroscience 2023
Quote:
Nicotinamide Riboside (NR) (BOC sciences cas no 1341-23-7) was supplemented as described in (35) ...
-
No products found
because this supplier's products are not listed.
Li Du, et al.,
bioRxiv - Microbiology 2022
Quote:
Assessment of Gal-9 effects on the binding of the SARS-CoV-2 spike to human ACE2 was performed using a commercially available spike-ACE2 binding assay kit (CoviDrop SARS-CoV-2 Spike-ACE2 Binding Activity/Inhibition Assay Kit, EPIGENTEK, D-1005-48) following the protocol provided by the manufacturer ...
-
No products found
because this supplier's products are not listed.
John DeSisto, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... FGF and PDGF A/B at 20 ng/μL (Shenandoah Biotechnology). Cells were passaged as required by trituration to break up the neurospheres and replacement of the medium.
-
No products found
because this supplier's products are not listed.
Kari Martyniak, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 5.832g, Oakwood Chemical) were added to the solution under stirring to activate 30 % of the carboxylic acids of the oxidized alginate ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 2: 2-Amino-6-(prop-2-ynoxycarbonylamino)hexanoic acid (LysAlk, AstaTech); 3 ...
-
No products found
because this supplier's products are not listed.
Catherine S. Liou, et al.,
bioRxiv - Microbiology 2024
Quote:
... 12 g Sfär C18 D Duo column (Biotage). Water with 0.1% (v/v ...
-
No products found
because this supplier's products are not listed.
Vidyanand Anaparti, et al.,
bioRxiv - Physiology 2019
Quote:
... Concentrations of 25(OH)D (OKEH02569; Aviva Systems Biology) and VDBP were measured using ELISA kits as per the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Wren E. Michaels, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Quantitative analysis of the CFTR B and C-bands was performed using Compass software (Protein Simple).
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Hyunjun Yang, Adam G. Kreutzer, James S. Nowick,
bioRxiv - Microbiology 2023
Quote:
... Fmoc-N-Me-D-Gln(Trt)-OH was purchased from ChemPep. Other protected amino acids were purchased from CHEM-IMPEX ...
-
No products found
because this supplier's products are not listed.
Marc-Joseph Antonini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and Ag/AgCl electrode (BASi, 3 M NaCl) were used as the counter and reference electrodes ...
-
No products found
because this supplier's products are not listed.
Arun Upadhyay, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Stock solutions of recombinant Aβ peptides were prepared by solubilizing lyophilized monomers (Aβ38, rPeptide A-1078-2; Aβ40:rPeptide A-1153-2; and Aβ42: rPeptide A-1163-2) in 1% NH4OH at 200 µM concentration as recommended by manufacturer ...
-
No products found
because this supplier's products are not listed.
Nadya Povysheva, Huiyuan Zheng, Linda Rinaman,
bioRxiv - Neuroscience 2021
Quote:
... adult male Sprague-Dawley rats (n=3; 225-250 g BW) were anesthetized by isoflurane inhalation (1-3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device in the flat skull position ...
-
No products found
because this supplier's products are not listed.
Kristoffer Krogerus, Nils Rettberg, Brian Gibson,
bioRxiv - Microbiology 2022
Quote:
... after which spores from the different parental strains were dissected and placed next to each other on YPD agar plates (1 % yeast extract, 2 % peptone, 2 % glucose, and 2 % agar) using a micromanipulator (Singer Instruments, UK). The plates were incubated at 25 °C for 3 days ...
-
No products found
because this supplier's products are not listed.
Shanti Pal Gangwar, et al.,
bioRxiv - Biophysics 2019
Quote:
Crystallization screening was performed with GLR3.2-S1S2 protein at a concentration of ~7 mg/ml using Mosquito robot (TTP Labtech) and sitting drop vapor diffusion in 96-well crystallization plates ...
-
No products found
because this supplier's products are not listed.
Shikha Yadav, et al.,
bioRxiv - Cell Biology 2023
Quote:
Day 7 BMDMs were washed twice to remove traces of FCS and then incubated in starvation medium from Cell applications Inc ...
-
No products found
because this supplier's products are not listed.
Timothy N. Hoang, et al.,
bioRxiv - Immunology 2020
Quote:
... Rabbit Polink-2 HRP (GBI Labs; Cat ...
-
No products found
because this supplier's products are not listed.
Lihong Chen, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... 2 mg monoclonal antibody to collagen II (Chondrex) in 50 ul of PBS was administered by intraperitoneal injection ...
-
No products found
because this supplier's products are not listed.
Kaito Nagashima, et al.,
bioRxiv - Immunology 2021
Quote:
... The protein was expressed in 2 L of Sf9 cells at 2×106 cells/mL maintained in ESF921 media (Expression Systems) by adding 25 mL virus per liter of culture ...
-
No products found
because this supplier's products are not listed.
Peter Vandeberg, et al.,
bioRxiv - Immunology 2020
Quote:
Anti-SARS-CoV-2 IgG titers were determined using Human Anti-SARS-CoV-2 Virus Spike 1 (S1) IgG assay (Alpha Diagnostic). hIVIG batches were tested using multiple serial dilutions and a curve constructed by plotting the log of the optical density as a function of the log of the dilution ...