-
No products found
because this supplier's products are not listed.
Md Gulam Musawwir Khan, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Cell survival was measured using the WST-8 (water-soluble Tetrazolium-8: 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)- 5- (2,4-disulfophenyl)-2H-tetrazolium) assay kit (CCK-8; Dojindo Molecular Technologies, #CK04) following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Kristen A. Gaffney, et al.,
bioRxiv - Biophysics 2021
Quote:
... iodoacetyl-7-nitrobenz-2-oxa-1,3-diazol (IA-NBD, Setareh Biotech) (42) ...
-
No products found
because this supplier's products are not listed.
Krista L. Newell, et al.,
bioRxiv - Immunology 2021
Quote:
... spike protein probes were added one-by-one to FACS wash buffer (1x PBS, 2% fetal bovine serum) containing 5μM free d-biotin (Avidity, Cat. Bir500A). Both streptavidin-fluor conjugates were used to stain DMSO control samples to further verify the absence of significant frequencies of non-specific streptavidin-binding B cells.
-
No products found
because this supplier's products are not listed.
Mathieu Paquette, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... cells were incubated for either 24 h or 7 days in medium containing one or a combination of the following reagents: DMSO (Bioshop Canada, DMS666), Doxorubicin (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Hillary A. Wadsworth, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and 5-(3-Bromophenyl)-1,3-dihydro-2H-benzofuro[3,2-e]-1,4-diazepin-2-one (5-BDBD) (cat. no. T22518, TargetMol, Wellesley Hills, Massachusetts, USA) were dissolved in stock solutions and then diluted into ACSF at specified concentrations (50 µM IVM ...
-
No products found
because this supplier's products are not listed.
José Miguel Arcas, et al.,
bioRxiv - Neuroscience 2024
Quote:
... of 1% RAP in one eye or vehicle (8% ethanol, 2% Cremophor in saline) in the other using a graduated micropipette (Gilson Pipetman P2). Each solution was applied for 2 minutes ...
-
No products found
because this supplier's products are not listed.
Zezhong Zheng, et al.,
bioRxiv - Bioengineering 2022
Quote:
Gene editing of COS-7 cells were performed by electroporation of COS-7 cells with Super PiggyBac plasmid (PB210PA-1, System Biosciences) and one of the 5 plasmids of pBv1-EF-6X ...
-
No products found
because this supplier's products are not listed.
Stephanie Bruggink, et al.,
bioRxiv - Physiology 2021
Quote:
... A female luer (Figure 1H thread style to 500 series barb 1/16 inch ID tubing Cole-Parmer Instrument #SK-45508-01 connected to tubing Picture 1B Silastic Laboratory Tubing #508-005 ...
-
No products found
because this supplier's products are not listed.
Raj Kumar Sadhu, et al.,
bioRxiv - Biophysics 2022
Quote:
... Flash Red polystyrene beads (Bangs Laboratories Inc., 7 µm diameter) were washed three times in sterile PBS and opsonized overnight at 4°C in 3 mg/mL mouse IgG (Invitrogen) ...
-
No products found
because this supplier's products are not listed.
Patrícia Dias Carvalho, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... After one wash in 1% bovine serum albumin (BSA; NZYtech) in PBS 1x ...
-
No products found
because this supplier's products are not listed.
Qixiang He, et al.,
bioRxiv - Biochemistry 2021
Quote:
One or two liters of Trichoplusia (Tni) cells (Expression System) were infected with recombinant baculoviruses at a cell density of 1.5-2.0 × 106 cells per mL ...
-
No products found
because this supplier's products are not listed.
Govind Nair, et al.,
bioRxiv - Bioengineering 2024
Quote:
... and spun down for one minute (MyFuge C1012, Benchmark Scientific). Samples in 8-well tubes were heat-shocked for three minutes at 72 °C (C1000 Touch Thermal Cycler ...
-
No products found
because this supplier's products are not listed.
Reza Nejat, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... Ubiquitin−7-amino-4-methylcourmarin (Ub-AMC) was purchased from Boston Biochem; human ISG15−7-amino-4-methylcourmarin (ISG15-AMC ...
-
No products found
because this supplier's products are not listed.
Shao-Jung Hsu, et al.,
bioRxiv - Neuroscience 2020
Quote:
... one given adeno-associated virus (AAV)8-mouseVEGF-C (Vector Biolabs, Malvern, PA) and the other given AAV8-GFP (control ...
-
No products found
because this supplier's products are not listed.
Koji Ohira, et al.,
bioRxiv - Neuroscience 2019
Quote:
... One group was treated with FLX pellets (Innovative Research of America, Sarasota, FL) for 4 weeks at a dose of 3 mg/kg/day ...
-
2 Well Chambered Cover Glass with #1.5 high performance cover glass (0.170±0.005mm), with lid,...
Cat# C2-1.5H-N,
48/case, $219.00
Ask
Chao Wang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... cells were cultured on a one-well chambered coverglass (Cellvis, C1-1.5H-N) for 24 hours and then were treated with 7.5 μM RO-3306 for 18 hours ...
-
No products found
because this supplier's products are not listed.
Ningning Zhang, et al.,
bioRxiv - Plant Biology 2021
Quote:
... Each sample was aliquoted and one of them was added with ascorbate (Thomas Scientific LLC, C988F55) to a final concentration of 100 mM ...
-
No products found
because this supplier's products are not listed.
Terry R. Suk, et al.,
bioRxiv - Neuroscience 2022
Quote:
... cDNA was synthesized using 5X All-in-One RT Master Mix (Bio Basic cat# HRT025-10) following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Megan Clapperton, et al.,
bioRxiv - Biophysics 2023
Quote:
... and fluorescence (PMT 2).
-
No products found
because this supplier's products are not listed.
Shahanshah Khan, et al.,
bioRxiv - Immunology 2021
Quote:
... SARS-CoV-2 M (MyBioSource, MBS8574735) and SARS-CoV-2 E (MyBioSource ...
-
No products found
because this supplier's products are not listed.
Kenneth H. Risner, et al.,
bioRxiv - Microbiology 2022
Quote:
... SARS-CoV-2 Spike Antibody (ProSci, 3525) was also used to detect expressed S-protein ...
-
No products found
because this supplier's products are not listed.
Qiong Wang, et al.,
bioRxiv - Immunology 2019
Quote:
One immunization to induce CIA : Bovine type II collagen (2 mg/ml, Chondrex, cat. # 20021) and complete Freund’s adjuvant (4mg/ml M ...
-
No products found
because this supplier's products are not listed.
Michelle A. Baird, et al.,
bioRxiv - Cell Biology 2023
Quote:
... cells were cultured for 7 days in Tu 2% media (1205Lu) supplemented with lipid depleted FBS (Omega Scientific, Fisher Scientific). Dox inducible LBR KD was initiated 3 days prior to the experiment ...
-
No products found
because this supplier's products are not listed.
Thomas I. R. Hopkins, et al.,
bioRxiv - Biophysics 2021
Quote:
... 100% (3 × 1h)) and then placed in Histoclear (Cat. No HS-200, National Diagnostics) overnight ...
-
No products found
because this supplier's products are not listed.
Lindsey Van Haute, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Bisulfite conversion of 2 µg DNase treated RNA was performed using the Methylamp One-Step DNA modification kit (Epigentek). The reaction mixture was incubated for three cycles of 90°C for 5 min and 60°C for 1h ...
-
No products found
because this supplier's products are not listed.
Robert S. Porter, et al.,
bioRxiv - Molecular Biology 2023
Quote:
One μg of recombinant (Epicypher) or cellular nucleosomes (see protein purification above ...
-
No products found
because this supplier's products are not listed.
Minal Engavale, et al.,
bioRxiv - Immunology 2023
Quote:
... Portions of the blot were incubated with one of the following primary antibodies for 2 hours at room temperature or overnight: anti-human Dnase1L3 (1:1000) (Abnova and Genetex), pre-immune rabbit serum (1:5000) ...
-
No products found
because this supplier's products are not listed.
Raphael A. Reyes, et al.,
bioRxiv - Immunology 2024
Quote:
... One hundred fifty µL blocking buffer (one-third Non-Animal Protein (NAP)-Blocker (G-Biosciences #786-190P) and two-thirds PBS ...
-
No products found
because this supplier's products are not listed.
Dalia E. Gaddis, et al.,
bioRxiv - Immunology 2019
Quote:
... Nrp1 (clone N43-7; MBL International, Woburn, MA), and CD45.1 (clone A20 ...
-
No products found
because this supplier's products are not listed.
Bowen Qiu, et al.,
bioRxiv - Pathology 2020
Quote:
... A microsyringe (#7635-01, Hamilton Company, 7 Reno, Nevada) with a 30-gauge needle (#7803-07 ...
-
PEGSSDA allows researchers to quickly and gently dissolve HyStem® hydrogels non-enzymatically...
Cat# GS755-2EA,
0.5 mL, USD $160.0
Ask
Ines A Cadena, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and gelatin methacryloyl (GelMA, 7% w/v, Advanced BioMatrix) were crosslinked using the UV photo crosslinker irgacure 2959 for 1 minute under a 365 nm UV light crosslinking source according to protocols specified by the manufacturer ...
-
LC Laboratories' Product Number S-1700 - SB 202190, Free Base (FHPI, SB202190,...
Cat# S-1700, SKU# S-1700_100mg,
100 mg, $89.00
Ask
Josh Tycko, et al.,
bioRxiv - Systems Biology 2023
Quote:
... in one well 100 nM Rapamycin (LC Laboratories) was added and the other well contained regular RPMI complete media ...
-
No products found
because this supplier's products are not listed.
Bo Liang, et al.,
bioRxiv - Microbiology 2020
Quote:
... KCl (CAS 7447-40-7) (Spectrum Chemicals, New Brunswick, NJ) and water ...
-
No products found
because this supplier's products are not listed.
Mark K. Adams, et al.,
bioRxiv - Systems Biology 2019
Quote:
... One mL of FBS (Peak Serum, Inc, Wellington CO) was added the next morning ...
-
No products found
because this supplier's products are not listed.
Takuro Shimaya, et al.,
bioRxiv - Cell Biology 2020
Quote:
... The streptavidin decoration of the cellulose membrane (Spectra/Por 7, Repligen, Waltham Massachusetts ...
-
No products found
because this supplier's products are not listed.
Damian Dudka, R. Brian Akins, Michael A. Lampson,
bioRxiv - Cell Biology 2023
Quote:
... and incubated for at least 1h prior to microinjection on a hot plate (38°C) under mineral oil (FUJIFILM Irvine Scientific; 9305). Oocytes were then microinjected with ~5 pl of mRNAs in M2 medium with 2.5 mM milrinone and 3mg/mL BSA at room temperature with a micromanipulator TransferMan NK 2 (Eppendorf ...
-
No products found
because this supplier's products are not listed.
Ria Lassaunière, et al.,
bioRxiv - Immunology 2023
Quote:
... A 100 μL TMB One Substrate (Cat. # 4380, KemEnTec, Denmark) was added and incubated for 15 minutes ...
-
No products found
because this supplier's products are not listed.
Joanna Domagala, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... MCF-7 cells were seeded on 16-well E-Plates (ACEA Biosciences) at a cell density 3 × 104 per well in 150 μl of the DMEM medium and monitored for 24h ...
-
No products found
because this supplier's products are not listed.
Austin T. Baldwin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... one dorsal blastomere was injected with 1ng Cas9 protein (PNA Bio), 250pg shroom3-targeted sgRNA (target sequence GUAGCCGGAGAGAUCACUUG ...
-
No products found
because this supplier's products are not listed.
Matthew G. Blango, et al.,
bioRxiv - Microbiology 2021
Quote:
... One scoop of 0.15 mm zirconium oxide beads (Next Advance; ZrOB015) was added to each tube and bacteria were lysed using a Bullet Blender (Next Advance ...
-
Magnetofection
diificult to transfect cells
Cat# KC30400,
SilenceMag 200µL + PolyMag 100µL + PolyMag Neo 100µL+ CombiMag 100µL + Magnetic plate MF10000, USD $798.00/KIT
Ask
Ariel Caviedes, et al.,
bioRxiv - Neuroscience 2020
Quote:
Neuronal cultures of 7 DIV were transfected using magnetic nanoparticles (NeuroMag, Oz Biosciences). Briefly ...
-
No products found
because this supplier's products are not listed.
Adriana Blazeski, et al.,
bioRxiv - Bioengineering 2023
Quote:
... at passage 7 were maintained in FibroLife S2 Fibroblast Medium (Lifeline Cell Technology) and cultured until 50-70% confluency prior to use in MVNs ...
-
WB, IHC, IF,ELISA
Cat# A5522, SKU# A5522-100ul,
100ul, $157.00
Ask
Yini Zhu, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and reverse transcribed using the All-in-One cDNA Synthesis Kit (Bimake, B24403). qRT-PCR was performed using SYBR Green qPCR Master Mix (Bimake ...
-
No products found
because this supplier's products are not listed.
Erick X. Pérez-Guzmán, et al.,
bioRxiv - Microbiology 2019
Quote:
... RNAemia levels were measured by a One-Step qRT-PCR detection kit (Oasig, Primerdesign Ltd., UK) and using DENV RT primer/probe Mix kit (Genesig ...
-
No products found
because this supplier's products are not listed.
R. Wercberger, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2% Fluoro-Gold (Fluorochrome), or the HSV-hEF1a-GFP-L10a.
-
No products found
because this supplier's products are not listed.
Jinyuan Vero Li, et al.,
bioRxiv - Biophysics 2020
Quote:
... The nanogold was silver enhanced for 7 min using an HQ silver enhancement kit (Cat# 2012-45 mL, Nanoprobes). The silver was further stabilised by gold toning that involved 15 min incubation in 2% w/v sodium acetate ...
-
No products found
because this supplier's products are not listed.
Jeremy Krohn, et al.,
bioRxiv - Neuroscience 2022
Quote:
... guinea pig anti perilipin-2 (Perilipin-2; 1:1000; Progen Cat# GP40, RRID:AB_2895086), mouse anti glial fibrillary acidic protein (GFAP ...
-
No products found
because this supplier's products are not listed.
Mareike Monschein, et al.,
bioRxiv - Microbiology 2022
Quote:
... Cat.# P0705S); endo-1,4-β-D-glucanase (cellulase from Trichoderma longibrachiatum, glycoside hydrolase family 7; Cat.# E-CELTR) from Megazyme. BsEXLX1 (expansin from Bacillus subtilis ...
-
No products found
because this supplier's products are not listed.
Mansi Prakash, et al.,
bioRxiv - Neuroscience 2021
Quote:
... containing 2 mg/ml papain (BrainBits). Papain solution was removed ...
-
No products found
because this supplier's products are not listed.
Mai M. Abdelmoaty, et al.,
bioRxiv - Immunology 2021
Quote:
... Recombinant human IFN-α (PBL Assay Science, 11200-2) was used as assay standard ...