-
No products found
because this supplier's products are not listed.
Helen J. von Richthofen, et al.,
bioRxiv - Immunology 2022
Quote:
... or proteinase 3 (Elastin Products Company) (all 1 μM) ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
No products found
because this supplier's products are not listed.
Jijin R. A. Kuttiyatveetil, et al.,
bioRxiv - Biochemistry 2021
Quote:
... ICP-MS standards QCP-QCS-3 (Inorganic Ventures) and QCS-27 (High Purity Standards ...
-
No products found
because this supplier's products are not listed.
Eman A. Akam, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Tert-Butyl 3-aminopropoxycarbamate was purchased from AmBeed and used without further purification ...
-
No products found
because this supplier's products are not listed.
Jean-Hugues Guervilly, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Cells were usually fixed and stained 7 to 8 days later when visible colonies could be counted with a Scan 1200 automatic colony counter (Interscience).
-
No products found
because this supplier's products are not listed.
Galen J. Correy, et al.,
bioRxiv - Biochemistry 2022
Quote:
... mounted on B3-3 magnetic bases (Mitegen, GB-B3-R). MicroRT tubing (Mitegen ...
-
No products found
because this supplier's products are not listed.
Clara Alameda, et al.,
bioRxiv - Neuroscience 2023
Quote:
... participants were fitted with 3-ECG electrodes (Ambu, Ballerup, Denmark) and a 64-channel actiCHamp EEG system (Brain Products ...
-
No products found
because this supplier's products are not listed.
Eric Waltari, et al.,
bioRxiv - Immunology 2019
Quote:
We printed our arrays with the PDC70 type 3 nozzle (Scienion) due to its reduced dispense volume and the specific hydrophobic coating optimized to improve the dispense stability of protein solutions ...
-
No products found
because this supplier's products are not listed.
Shivani Ahuja, et al.,
bioRxiv - Biochemistry 2020
Quote:
... the protein was mixed 2:3 with monoolein (Nu-Chek Prep) and then 70 nl of this material was deposited on a glass slide (Molecular Dimensions) ...
-
Cat# ACT-AVM3000-2,
USD $39.29/ea
Ask
Daniela Rubio-Olaya, et al.,
bioRxiv - Biophysics 2022
Quote:
... pH 8) in the presence of HydraGreen (3 mL, ACTGene, USA) as the intercalating agent ...
-
No products found
because this supplier's products are not listed.
Gurcharan Kaur, et al.,
bioRxiv - Genetics 2023
Quote:
... stained with Alcian blue (1% in 3% Acetic Acid, Poly Scientific) for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Weng Hua Khoo, et al.,
bioRxiv - Immunology 2022
Quote:
... Proliferating cells remaining in the cultures were further expanded by incubating for a further 7 days with 20 IU/mL IL-2 (Roche Life Science Products). After expansion ...
-
No products found
because this supplier's products are not listed.
Natalia Sanchez de Groot, et al.,
bioRxiv - Systems Biology 2019
Quote:
... Aβ42 was inserted 3’prime of the GFP (TRP-URA-AB vector) using the In-Fusion® HD Cloning Kit (Clontech ...
-
No products found
because this supplier's products are not listed.
A Prabhakar, et al.,
bioRxiv - Immunology 2021
Quote:
... 2-3 ml blood was collected in RNAgard blood tubes (Biomatrica, USA) and stored in −80°C until RNA precipitation ...
-
No products found
because this supplier's products are not listed.
Xingyue An, et al.,
bioRxiv - Immunology 2020
Quote:
... 2′-3’′cyclic guanosine monophosphate adenosine monophosphate (cGAMP) from Chemietek (Indianapolis, IN). 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) ...
-
No products found
because this supplier's products are not listed.
Raeann Goering, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... HCA-7 cells were maintained in a 1:1 mix of DMEM and F12 (Thermo 11320033) supplemented with 10% FBS (Atlas Biologicals F-0500-D) and penicillin-streptomycin (Thermo 15140122) ...
-
No products found
because this supplier's products are not listed.
Elena Martínez-Balsalobre, et al.,
bioRxiv - Genetics 2021
Quote:
... A 3-mm-diameter platinum plate electrode (CUY 650-P3 Tweezers, Protech International) localized the pulses to approximately the dorsal one-half of the fin ...
-
No products found
because this supplier's products are not listed.
Kristina Astleford-Hopper, et al.,
bioRxiv - Cell Biology 2022
Quote:
3-month-old femora were isolated and fixed in Z-fix (Anatech LTD) and placed in 10% EDTA (pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Joshua Johnson, et al.,
bioRxiv - Physiology 2020
Quote:
... Endogenous peroxidase blocking was performed by using 3% hydrogen peroxide (Labchem, Cat # LC154301). Sections were then washed in water ...
-
No products found
because this supplier's products are not listed.
Yann Ehinger, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Rabbit anti-VGUT1 antibody (VGT1-3) was purchased from Mab Technologies (Stone Mountain, GA). Other common reagents were from Sigma Aldrich (St ...
-
No products found
because this supplier's products are not listed.
Eileen M. Lynch, et al.,
bioRxiv - Pathology 2024
Quote:
... Amplified samples were run on a 2% agarose gel (Lamda Biotech, Inc., A113-3) containing 0.5μg/mL ethidium bromide (Millipore Sigma ...
-
No products found
because this supplier's products are not listed.
Christoph Schmitz, et al.,
bioRxiv - Bioengineering 2024
Quote:
... 2-axis computer-controlled stepping motor system (4”× 3” XY; Prior Scientific, Jena, Germany), focus encoder (Heidenhain ...
-
No products found
because this supplier's products are not listed.
G. Caplen, S.D.E. Held,
bioRxiv - Zoology 2021
Quote:
Saliva was collected (Day 3) using a cotton swab (SalivaBio Children’s Swab, Item No. 5001.06, Salimetrics) and then immediately stored at −80°C prior to analysis ...
-
No products found
because this supplier's products are not listed.
Natalie Wolf, et al.,
bioRxiv - Immunology 2021
Quote:
Mice were injected subcutaneously on the right flank with 100 μg of 3-methylcholanthrene (Crescent Chemical) in peanut oil ...
-
No products found
because this supplier's products are not listed.
Soner Sonmezoglu, et al.,
bioRxiv - Bioengineering 2021
Quote:
... tris-(Bathophenanthroline) Ruthenium (II) Perchlorate (Ru(dpp)3(ClO4)2) (CAS 75213-31-9; GFS Chemicals), were immobilized on the surface of silica particles with a diameter of 10 µm (CAS 7631-86-9 ...
-
No products found
because this supplier's products are not listed.
Benjamin M. David, Paul A. Jensen,
bioRxiv - Systems Biology 2022
Quote:
... Samples were homogenized for 3 minutes in two 90 s intervals at 1600 rpm (OHAUS homogenizer), then heated at 65 °C for 5 minutes ...
-
No products found
because this supplier's products are not listed.
Alexandra A. Silverman, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... the cells were incubated for 3 hours and then imaged with a coverglass lid (Bioptechs, 4200312) using a Nikon ECLIPSE TE2000-E inverted microscope ...
-
No products found
because this supplier's products are not listed.
Biao Yuan, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and desalting (3 min) was driven with an isocratic HPLC pump (IPro-500, IRIS Technologies, Lawrence, KS) at a flow rate of 100 µL min-1 through the 50-µL sample loop ...
-
No products found
because this supplier's products are not listed.
Rebekka Medert, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Pools of 2 or 3 E4.5 blastocysts were lysed in 10 μl lysis buffer (DirectPCR buffer, Viagen, supplemented with 2.5 μg/ml Proteinase K ...
-
No products found
because this supplier's products are not listed.
Cathrin LC Gudd, et al.,
bioRxiv - Immunology 2023
Quote:
... 20 μg/mouse of TLR9-L (CpG oligodeoxynuleotide 1668: 5-S-TCCATGACGTTC CTGATGCT-3) (TIB Molbiol, Germany) was administered i.p ...
-
No products found
because this supplier's products are not listed.
Néstor Sampedro Vallina, et al.,
bioRxiv - Bioengineering 2023
Quote:
... (5Z)-5-[(3,5-Difluoro-4-hydroxyphenyl)methylene]-3,5-dihydro-2-methyl-3-(2,2,2-trifluoroethyl)-4H-imidazol-4-one (DFHBI-1T) was purchased from Lucerna Technologies ...
-
No products found
because this supplier's products are not listed.
Adrian T. Press, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 1,2-Dipalmitoyl-sn-glycerol-3-phosphoethanolamine (DPPE) azide was conjugated to DY-635-alkin (Dyomics GmbH, Jena, Germany) and used to prepare liposomes using a 100 nm extruder ...
-
No products found
because this supplier's products are not listed.
Paul D. Simonson, Itzel Valencia, Sanjay S. Patel,
bioRxiv - Immunology 2022
Quote:
... we created the following custom-conjugated oligomer (5’ to 3’, custom orders to Gene Link, Elmsford, New York):
-
No products found
because this supplier's products are not listed.
Rene Yu-Hong Cheng, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 3 mL syringes (Becton Dickinson) were connected to the bead and sample inlet reservoirs via PEEK tubing (IDEX) and a coupler molded out of PDMS ...
-
Cat# FGF7-14H,
10ug : USD $159, 50ug : USD $398, 100ug : USD $598
Ask
Tam Vo, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... The expression and purification of the HNRNPH1 truncated proteins qRRM1-2 and qRRM2-3 (Creative BioMart, Shirley, NY) were performed as described previously (23) ...
-
No products found
because this supplier's products are not listed.
Temitayo T. Bamgbose, et al.,
bioRxiv - Immunology 2023
Quote:
... allowed to sit for 3 hours and treated with recombinant mouse IL-4 (Leinco technologies, Inc. I-207) for 4 hr ...
-
No products found
because this supplier's products are not listed.
Antonio Frasca, et al.,
bioRxiv - Bioengineering 2020
Quote:
8-10 mm discs of BP were rinsed 3 times in 0.9% saline (Rocky Mountain Biologicals, Missoula, MT, USA) and then incubated for 24 hours at 37°C in 0.9% saline ...
-
No products found
because this supplier's products are not listed.
Gary Reynolds, et al.,
bioRxiv - Immunology 2020
Quote:
... then resuspended in 200 μl of flow buffer per 106 cells with 3 μM DAPI (Sysmex Partec, 05-5005). Cells were then run through a Fortessa X20 for analysis ...
-
No products found
because this supplier's products are not listed.
Kira Cozzolino, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Nuclear run-ons were performed for 3 minutes at 37°C on a Groovin’ Tubes thermoshaker (Boekel Scientific, 270500), on a mixture of 10 million human and 100,000 Drosophila melanogaster nuclei per replicate ...
-
No products found
because this supplier's products are not listed.
Clara Taffoni, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... cGAMP enzyme-linked immunosorbent assay (ELISA) was performed according to the manufacturer’s protocol using the Cayman Chemical 2′3′-cGAMP ELISA Kit (Bertin Bioreagents).
-
No products found
because this supplier's products are not listed.
Maia Moog, Scott C. Baraban,
bioRxiv - Neuroscience 2022
Quote:
... were amplified at a gain of 20x and filtered at 1 kHz (−3 dB; eight-pole Bessel; Cygnus Technology, Inc.), digitized at 10 kHz using a Digidata 1320 A/D interface (Molecular Devices ...
-
No products found
because this supplier's products are not listed.
Wen Wei Yan, et al.,
bioRxiv - Neuroscience 2020
Quote:
Mice were anesthetized with isoflurane (initial dose 3%; maintenance dose 1.5%) and injected intracranially with red retrobeads (Lumafluor, Raleigh, NC). A targeted microinjection of the retrobeads (100 nL ...
-
No products found
because this supplier's products are not listed.
Sarah C. Donnelly, et al.,
bioRxiv - Microbiology 2022
Quote:
... samples containing 1–3 mg/mL of protein were evaluated using ICP-MS (Biotron Analytical Services, Western University, London, Canada). Briefly ...
-
No products found
because this supplier's products are not listed.
Liang Wang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... both wild-type and LUZP1 knockout cells were cultured for 3-8 hours on custom made 35 mm dishes (Matrigen) coated with fibronectin and displaying specific stiffness (Young’s modulus = 25 kPa) ...
-
No products found
because this supplier's products are not listed.
Shikha Yadav, et al.,
bioRxiv - Cell Biology 2023
Quote:
... We measured ischemic (left)/non-ischemic (right) limb blood flow ratio using a laser Doppler blood flow (LDBF) analyzer (PeriScan PIM 3 System; Perimed) as we described (41 ...
-
No products found
because this supplier's products are not listed.
Cecilia S. Blengini, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Internal control Reverse: 5’ - GTAGGTGGA AATTCTAGCATCATC C- 3’) were used at 20 pMol using FastMix French PCR beads (Bulldog Bio, #25401) following manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Yuki Sato, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... The embryos were embedded in 3% agarose/PBS and subjected to vibratome sectioning into 140-μm-thick sections at 5100 mz (Campden Instruments). The slices were pre-blocked with 5% fetal bovine serum (FBS ...
-
No products found
because this supplier's products are not listed.
Lei Li, et al.,
bioRxiv - Immunology 2021
Quote:
... with 1 or 5 μg rSp alone or mixed with either 1 mg Advax-SM adjuvant or where indicated 50 μg Al(OH)3 (2% Alhydrogel, Croda Denmark) in the thigh muscle at weeks 0 and 2 ...
-
No products found
because this supplier's products are not listed.
Kirit Singh, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Cryopreserved PBMCs from healthy donors and from glioblastoma patients were then thawed into PrimeXV T-cell expansion media (FujiFilm) supplemented with 3% of human platelet lysate (hPL, Compass Biomedical) and pelleted at 300g for 10 min ...
-
No products found
because this supplier's products are not listed.
Ahmed Ali, et al.,
bioRxiv - Biophysics 2023
Quote:
... and sequentially in 1:3 dilution steps added to the wells of PEG-BSA coated ELISA plates (PBSA20PL, Life Diagnostics, Inc.) The plates were incubated for 2 h at RT to allow antibody binding ...